Information

RNA polymerase and DNA helicase

RNA polymerase and DNA helicase


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Is DNA helicase or RNA polymerase responsible for breaking the hydrogen bond between the 2 strands during transcription for eukaryotic cells? My textbook (WJEC Biology for AS level) says it is DNA helicase that breaks the hydrogen bonds while RNA polymerase catalyses the formation of bonds between RNA nucleotides.

The enzyme DNA helicase breaks the hydrogen bonds between the bases in a specific region of the DNA molecule. This causes the two strands to separate and unwind, exposing nucleotide bases. The enzyme RNA polymerase binds to the template strand of DNA at the beginning of the sequence to be copied.

However, when I searched online, for example on https://en.wikiversity.org/wiki/Effect_of_hydrogen_bond_on_RNA

Transcription can be explained easily in 4 or 5 simple steps, each moving like a wave along the DNA. RNA polymerase unwinds/"unzips" the DNA by breaking the hydrogen bonds between complementary nucleotides. RNA nucleotides are paired with complementary DNA bases. RNA sugar-phosphate backbone forms with assistance from RNA polymerase.

Then do RNA polymerase break hydrogen bonds? If RNA polymerase can break hydrogen bonds between strands then what is the role of DNA helicase in the transcription process?


Disclaimer

As I have pointed out in my comment, it is not clear whether the sources mentioned relate to eukaryotes or prokaryotes, assuming they are correct. I am a translation man, rather than a transcription man, and so am answering this from the 2002 edition of Berg et al. 'Biochemistry', as I happen to have a copy of my own (a freebie from when I was still teaching) and this edition is freely available online. List members with more expertise in this area are encouraged to post comments to correct any errors in my answer or supply updates.

Answer

  1. in neither prokaryotes nor eukaryotes is the DNA helicase that operates during DNA replication involved in transcription although other proteins necessary for transcription have DNA helicase activity.

  2. In prokaryotes it appears that the RNA polymerase holoenzyme (made up of just four subunits) is responsible for unwinding about 17 base-pairs of template DNA. Quoting from Section 28.1.3:

    Each bound polymerase molecule unwinds a 17-bp segment of DNA, which corresponds to 1.6 turns of B-DNA helix

    There may be some ambiguity caused by the description of how this value was determined experimentally as it involved addition of topoisomerase II. However it is clear from discussion elsewhere that this is an enzyme of DNA replication and is not involved in transcription.

  3. In eukaryotes transcription is much more complex, involving separate polymerases for different classes of RNA product and a variety of auxiliary transcription factors in the case of RNA polymerase II, which transcribes mRNA. According to Section 28.2.4:

    The TATA box of DNA binds to the concave surface of TBP [the TATA-box-binding protein]. This binding induces large conformational changes in the bound DNA. The double helix is substantially unwound to widen its minor groove, enabling it to make extensive contact with the antiparallel β strands on the concave side of TBP.

    So the initial recognition of the TATA box causes some unwinding. However the major player appears to be transcription factor TFIIF:

    an ATP-dependent helicase that initially separates the DNA duplex for the polymerase


RNA polymerase or DNA helicase. And gene expression.

So during transcription in the nucleus, the DNA strand is 'unzipped' so the sequence of complementary bases can be copied and mRNA taken out of the nucleus and onto a ribosome. Is it DNA helicase which break the hydrogen bonds within the DNA or is it RNA polymerase? I though it was DNA helicase which break the hydrogen bonds/ or unzip, and the RNA polymerase which gather all the components to form the mRNA strand. Is this right, and please correct anything I've gotten wrong.

ALSO, what is the difference between the operator gene and the promoter region? Is it that: the repressor molecule attaches to the operator gene to prevent the RNA polymerase binding, but if the repressor molecule is absent, the promoter region is where the RNA polymerase will bind? Again please correct anything which is wrong, this kinda confuses me

Thank you

Not what you're looking for? Try&hellip

(Original post by ilovefruit)
So during transcription in the nucleus, the DNA strand is 'unzipped' so the sequence of complementary bases can be copied and mRNA taken out of the nucleus and onto a ribosome. Is it DNA helicase which break the hydrogen bonds within the DNA or is it RNA polymerase? I though it was DNA helicase which break the hydrogen bonds/ or unzip, and the RNA polymerase which gather all the components to form the mRNA strand. Is this right, and please correct anything I've gotten wrong.

ALSO, what is the difference between the operator gene and the promoter region? Is it that: the repressor molecule attaches to the operator gene to prevent the RNA polymerase binding, but if the repressor molecule is absent, the promoter region is where the RNA polymerase will bind? Again please correct anything which is wrong, this kinda confuses me

Thank you


Gene Expression: Transcription of the Genetic Code

RNA Polymerase I and III-Directed Transcription

Eukaryotic RNA polymerases I and III rely on a distinct set of proteins to initiate transcription. Although both RNA polymerases I and III share several identical core enzyme subunits with RNA polymerase II, they recognize very different promoter sequences and have unique general transcription factors. The promoters recognized by RNA polymerase I are not well conserved in sequence from one specie to another. However, they all have similar general architecture of the promoter as it consists of a core element surrounding the transcription start site, and an upstream promoter element, which is about 100 bp farther upstream. RNA polymerase I, which transcribes rRNA genes, binds to promoter containing a core promoter element and an upstream control element (UCE). The TBP, which is part of a larger complex called SL1, helps RNA polymerase I to recognize the core promoter ( Fig. 3.22 ). The classical RNA polymerase III promoters are Type I and Type II which have promoters that lie wholly within the genes. These Type I and Type II genes include a variety of RNA genes such as tRNA, the 5S RNA subunit of the ribosome, and adenovirus VA RNA genes ( Fig. 3.23 ). The Type III RNA polymerase III promoters is nonclassical and it resembles those of Class II genes including U6 snRNA gene, the 7SL RNA gene, and the 7SK RNA gene.

Fig. 3.22 . RNA pol I promoters contain a core region as well as an upstream control element (UCE), which interact with transcription factors like UBF and SL1 in humans.

Fig. 3.23 . Examples of RNA polymerase III promoters. The red boxes signify promoters of 5S rRNA, tRNA and U6 snRNA genes. DSE represents a distal sequence element, PSE represents a proximal sequence element.


Mammalian Cells Can Convert RNA Segments Back Into DNA, New Research Reveals

A team of researchers from Thomas Jefferson University, Philadelphia, the University of Southern California, the Beckman Research Institute of the City of Hope, and the New York University School of Medicine has provided the first evidence that RNA sequences can be written back into DNA, a feat more common in viruses than eukaryotic cells.

Ternary structure of Polθ on a DNA/RNA primer-template: (A) Polθ polymerase (B) DNA/RNA extension by Polθ and PolθΔL (C) structure of Polθ:DNA/RNA:ddGTP (D) superposition of Polθ:DNA/RNA (marine) and Polθ:DNA/DNA (orange, 4x0q) the fingers and thumb subdomains undergo reconfiguration (E) superposition of Polθ:DNA/RNA (marine) and Polθ:DNA/DNA (orange, 4x0q) highlighting a 12-Å shift of K2181 (blue box thumb) and a 4.4-Å shift of E2246 (gray box palm) (F) superposition of nucleic acids and ddGTP from Polθ:DNA/RNA:ddGTP and Polθ:DNA/DNA:ddGTP structures (G) top: electron density of ddGTP and 3′ primer terminus in Polθ:DNA/RNA structure bottom: zoomed-in image of the superposition of active sites, illustrating a different conformation of ddGTP in the Polθ:DNA/RNA (blue) and Polθ:DNA/DNA (salmon) complexes (H) interactions between ribose 2’-hydroxyl groups of the RNA template and residues in the Polθ:DNA/RNA structure red dashed lines, hydrogen bonds (I) DNA/RNA used for cocrystallization with Polθ and ddGTP (top) strong electron density is present for four base pairs [nucleotides located at positions 2 to 5 (underlined) of the DNA/RNA] and two base pairs resulting from an incorporated ddGMP (2’,3’ dideoxyguanosine monophosphate) (green position 1) and a bound unincorporated ddGTP (red position 0) in the active site (top) interactions between Polθ and nucleic acids in Polθ:DNA/RNA:ddGTP (bottom) interactions between residues and phosphate backbone, sugar oxygen, or nucleobase are shown in blue, yellow, and green, respectively hydrogen bonds between Polθ and ribose 2’-hydroxyl groups are indicated (boxed residues) (J) interactions between Polθ and nucleic acids in Polθ:DNA/DNA:ddGTP (4x0q) color scheme identical to (I). Image credit: Chandramouly et al., doi: 10.1126/sciadv.abf1771.

“The reality that a human polymerase can do this with high efficiency, raises many question.”

“For example, this finding suggests that RNA messages can be used as templates for repairing or re-writing genomic DNA.”

In their study, Dr. Pomerantz and colleagues focused on a very unusual polymerase called polymerase theta (Polθ).

Of the 14 DNA polymerases in mammalian cells, only three do the bulk of the work of duplicating the entire genome to prepare for cell division.

The remaining 11 are mostly involved in detecting and making repairs when there’s a break or error in the DNA strands.

Polθ repairs DNA, but is very error-prone and makes many errors or mutations.

The scientists noticed that some of Polθ’s qualities were ones it shared with another cellular machine, albeit one more common in viruses — the reverse transcriptase.

Like Polθ, HIV reverse transcriptase acts as a DNA polymerase, but can also bind RNA and read RNA back into a DNA strand.

In a series of experiments, the authors tested Polθ against the reverse transcriptase from HIV, which is one of the best studied of its kind.

They showed that Polθ was capable of converting RNA messages into DNA, which it did as well as HIV reverse transcriptase, and that it actually did a better job than when duplicating DNA to DNA.

Polθ was more efficient and introduced fewer errors when using an RNA template to write new DNA messages, than when duplicating DNA into DNA, suggesting that this function could be its primary purpose in the cell.

Using X-ray crystallography, the team found that this molecule was able to change shape in order to accommodate the more bulky RNA molecule — a feat unique among polymerases.

“Our research suggests that Polθ’s main function is to act as a reverse transcriptase,” Dr. Pomerantz said.

“In healthy cells, the purpose of this molecule may be toward RNA-mediated DNA repair.”

“In unhealthy cells, such as cancer cells, Polθ is highly expressed and promotes cancer cell growth and drug resistance.”

“It will be exciting to further understand how Polθ’s activity on RNA contributes to DNA repair and cancer-cell proliferation.”


MATERIALS AND METHODS

Primer-template extension assays

Relative velocity of RT activity (Fig. 1B). Polθ (0.5 nM), HIV RT, and Polη (catalytic core, residues 1 to 514) were incubated with 10 nM radiolabeled DNA/RNA template (RP559/RP493R) for the indicated times in buffer A [25 mM tris-HCl (pH 7.8), 10 mM MgCl2, 0.01% (v/v) NP-40, 1 mM dithiothreitol (DTT), bovine serum albumin (BSA 0.1 mg/ml), and 10% (v/v) glycerol] with 100 μM dNTPs at 37°C. Percent extension was determined by dividing the intensity of the extended product by the intensity of the sum of extended and unextended products for each lane. All primer-template reactions were terminated with 25 mM EDTA and 45% (v/v) formamide then resolved in urea denaturing polyacrylamide gels and visualized by PhosphorImager. The rate of RT activity was determined from the slope of the linear portion of the plot representing steady-state conditions.

Comparison of polymerase activities on DNA/DNA and DNA/RNA (Fig. 1, D to G). The primer extension assays on DNA/RNA (RP559/RP493R) and DNA/DNA (RP559/RP493D) templates were performed using the conditions in Fig. 1B with the following changes. The indicated concentrations of the indicated polymerases were used, and the reactions were performed for 32 min.

Relative RT activity (Fig. 1H). The indicated polymerases were incubated with 10 nM radiolabeled DNA/RNA template (SM98/SM44R) for 20 min in the presence of 10 μM dNTPs at 37°C. Polθ and HIV RT reactions were performed in 25 mM tris-HCl (pH 8.0), 10 mM KCl, 10 mM MgCl2, 0.01% (v/v) NP-40, 1 mM DTT, BSA (0.1 mg/ml), and 10% (v/v) glycerol. AMV RT (20 units, New England Biolabs)–containing reactions were performed in buffer [50 mM tris-acetate (pH 8.3), 75 mM potassium acetate, 8 mM magnesium acetate, and 10 mM DTT] and contained BSA (0.1 mg/ml). M-MuLV RT (400 units, New England Biolabs)–containing reactions were performed in buffer [50 mM tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, and 10 mM DTT] and contained BSA (0.01 mg/ml).

Comparison of RT and DNA-dependent DNA synthesis activities by truncated and full-length Polθ (Fig. 1J). One hundred nanomolar of the indicated polymerases were incubated with 10 nM radiolabeled DNA/RNA (SM98/SM44R) or DNA/DNA (SM98/SM44) for 45 min with 50 μM dNTPs and 25 mM tris-HCl (pH 7.8), 2 mM MgCl2, 4 mM KCl, 6 mM NaCl, 0.01% (v/v) NP-40, 1 mM DTT, BSA (0.1 mg/ml), 10% (v/v) glycerol, and 750 μM adenosine triphosphate (ATP) at 37°C.

Relative velocity of single dNMP incorporation on radiolabeled DNA/RNA (Fig. 2, A to E). Polθ (2 nM) was incubated with 100 nM of the indicated radiolabeled DNA/RNA and DNA/DNA templates for the indicated times with 300 μM of the indicated dNTP in buffer [25 mM tris-HCl (pH 8.0), 10 mM MgCl2, 4 mM KCl, 6 mM NaCl, 0.01% NP-40, 1 mM DTT, BSA (0.01 mg/ml), and 10% (v/v) glycerol] at 37°C. Percent extension was determined as described above.

Relative velocity of nucleotide (dNMP) misincorporation (Fig. 2, F to J). Polθ (20 nM) was incubated with 100 nM of the indicated radiolabeled DNA/RNA and DNA/DNA templates and 300 μM of the indicated dNTP for the indicated times in buffer [25 mM tris-HCl (pH 8.0), 10 mM MgCl2, 10 mM KCl, 0.01% (v/v) NP-40, 1 mM DTT, BSA (0.1 mg/ml), and 10% (v/v) glycerol]. Percent extension was determined as described above. All oligonucleotides were radiolabeled using T4 polynucleotide kinase (New England Biolabs) and 32 P-γ-ATP (PerkinElmer) in recommended buffer for 37°C for at least 1 hour.

MMEJ cellular assay

Some of the methods used here are similar to those in a previously published article (38). iPSCs (2 × 10 5 ) were transfected in suspension with 0.25 μg each of the indicated left- and right-flanking DNA GFP constructs using Lipofectamine 2000 (Invitrogen). As a negative control, similar volume of buffer that was used in experimental wells was used for transfection in control wells. As a positive control to measure transfection efficiency, a wild-type linear DNA GFP expression construct was transfected simultaneously. GFP-positive cell frequencies were measured 3 days after transfection by flow cytometry using GUAVA easyCyte 5-HT (Luminex Corp.) in independent replicates and corrected for transfection efficiency and background events. Data are represented as the mean and SEM of three independent experiments, with at least duplicates per experiment. Statistical analysis was carried out by paired t test.

Preparation of GFP MMEJ reporter constructs

Some of the methods used here are similar to those in a previously published article (38). Polymerase chain reaction (PCR) preparation followed recommended conditions for the Phusion High-Fidelity DNA Polymerase (New England Biolabs M0530) using 10 ng of pCMV-GFP plasmid as template in 1× Phusion HF Buffer. PCR for the left-flank DNA was performed with primers RP500B and RP501. PCR for the right-flank DNA was performed with primers RP502 and RP503B. Following PCR, left- or right-flank DNA products were pooled together and digested with Dpn I (New England Biolabs) in 1× CutSmart buffer and then purified via Qiagen QIAquick PCR Purification Kit. PCR was then conjugated to streptavidin using PCR (110 ng/μl) and streptavidin (0.8 μg/μl) in 10 mM tris-HCl (pH 7.5) and 100 mM NaCl at 37°C for 1 hour. PCR for the left-flank DNA with five consecutive ribonucleotides was performed with primers RP500B and RP501. PCR was purified and then digested with Dpn I (New England Biolabs) and Sap I in 1× CutSmart buffer. PCR was purified again and then ligated to double-stranded DNA composed of annealed oligonucleotides RP550R-P and RP530a [oligos were annealed in the presence of a ribonuclease (RNase) inhibitor] for 16 hours at 16°C with T4 DNA Ligase (New England Biolabs) in 1× T4 DNA Ligase Buffer. Ligated PCR was purified and then conjugated to streptavidin as described above. PCR for the left-flank DNA with 10 consecutive ribonucleotides was prepared by the same methodology with ligation to the double-stranded DNA composed of oligos RP546P and RP530. Streptavidin conjugation and DNA amplification steps were confirmed in agarose gels stained with ethidium bromide.

CRISPR-Cas9 knock-in GFP reporter assay

The U2OS parental and POLQ e16m cell lines with the ∆7-reporter and CAS9/single guide RNA (sgRNA) plasmids to target the DSBs in this reporter, DNA oligonucleotide template, and control oligonucleotide (LUC) were previously described (36). The R2 oligonucleotide has the same sequence as the DNA oligonucleotides, but with two RNA bases in the 7 nt missing from the ∆7-reporter (IDT). The cell lines were seeded at 1 × 10 5 on a 12-well dish and transfected the following day, and % GFP was analyzed 3 days after transfection using a CyAN-ADP (DAKO) cytometer and normalized to transfection efficiency, as previously described (36). Transfections for the reporter assay contained 400 ng each CAS9/sgRNA plasmid, 10 pmol oligonucleotide, and 100 ng of either pCAGGS-BSKX (empty vector) or FLAG-POLQ expression vector (38). Transfections for transfection efficiency contained 400 ng of pCAGGS-NZE-GFP (GFP expression vector), 500 ng of empty vector (EV), and 10 pmol control oligonucleotide (36). Transfections were performed with 4 μl of Lipofectamine 2000 (Thermo Fisher Scientific) in 0.2 ml of Optimem (Thermo Fisher Scientific) and incubated with cells in 1 ml of antibiotic-free medium for 4 hours. Immunoblotting analysis for FLAG-POLQ involved extraction with ELB [250 mM NaCl, 5 mM EDTA, 50 mM Hepes, 0.1% (v/v) Ipegal, and Roche protease inhibitor] with sonication (Qsonica, Q800R) and using antibodies for FLAG (Sigma-Aldrich, A8592) or ACTIN (Sigma-Aldrich, A2066). Sequence analysis of reporter assay with R2 oligo: Cells were transfected as for the reporter assay with the R2 oligonucleotide template in the POLQ e16m cells with the POLQ expression vector, GFP + cells were isolated by fluorescence-activated cell sorting (FACS) (Becton Dickinson Aria Sorter), and the GFP repair product was amplified with CMVFWDFRT5 5′ CGCAAATGGGCGGTAGGCGTG and BGHREVFRT5 5′ TAGAAGGCACAGTCGAGG and sequenced with the CMVFWDFRT5 primer.

CDNA synthesis

cDNA synthesis reactions were performed by the indicated polymerase in the presence of 100 μM dNTPs and optimal buffer for each enzyme: Polθ [25 mM tris-HCl (pH 8.0), 10 mM KCl, 10 mM MgCl2, 0.01% (v/v) NP-40, 1 mM DTT, BSA (0.1 mg/ml), and 10% (v/v) glycerol] AMV RT [50 mM tris-acetate (pH 8.3), 75 mM potassium acetate, 8 mM magnesium acetate, 10 mM DTT, and BSA (0.1 mg/ml)] and M-MuLV RT [50 mM tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, and 10 mM DTT]. Reactions with synthetic DNA/RNA contained 10 ng of template. Polθ (100 nM), AMV-RT (20 units), or M-MuLV RT (400 units) were incubated at 37°C (Polθ) or 42°C (AMV-RT and M-MuLV RT) for 1 hour. Enzymes were then heat-inactivated at 85°C for 20 min. cDNA (0.1875 ng) was used for real-time PCR (Power SYBR Green Master Mix, Thermo Fisher Scientific) using primers SM246 and SM247.

Proteins

Polθ, Fl-Polθ, and Polδ were purified as previously described (1, 9). Pols β and λ were provided by S. Wilson. Polκ was purchased from Enzymax LLC. HIV RT RT52A optimized for x-ray crystallography was provided by Dr. E. Arnold. Polη was provided by Dr. S. Arora. Pols ε and α were provided by Dr. M. O’Donnell. Polγ Exo- was provided by Dr. W. Copeland. M-MuLV, AMV RTs, and KF Pols were purchased from New England Biolabs.

Protein purification for x-ray crystallography

The gene encoding Polθ (residues 1819 to 2590) was codon-optimized and cloned into the pSUMO vector to generate a sumo fusion that carries an N-terminal 6×His tag and a PreScission protease cleavage site. Polθ-expressing E. coli Rosetta(DE3)pLysS cells were cultured at 37°C in LB medium until optical density at 600 nm (OD600) reached 0.3, the growth temperature was then lowered to 16°C, and E. coli cells were further cultured. Protein expression was induced by the addition of 0.1 mM isopropyl β- d -thiogalactopyranoside when OD600 reached 0.7 to 0.9. E. coli cells were cultured at 16°C overnight and harvested by centrifugation. Cell pellet was resuspended in buffer L [50 mM Hepes (pH 8.0), 500 mM NaCl, 0.005% (v/v) Igepal CA 630, and 0.5 mM TCEP] lysed by sonication or French Press in the presence of DNase I (20 μg/ml), RNase A (30 μg/ml), 5 mM MgCl2, 2 mM CaCl2, and 1 mM phenylmethylsulfonyl fluoride and then centrifuged at 12,000g for 45 min. 6×His sumo fusion was captured by Ni-NTA agarose gravity-flow chromatography followed by a series of washes by buffer W [50 mM Hepes (pH 8.0), 500 mM NaCl, 0.005% (v/v) Igepal CA 630, 0.5 mM TCEP, and 10 mM imidazole]. Five milliliters of buffer L and Precission Protease was added to cleave Polθ from the 6×His tag by staying overnight at 4°C. The cleaved Polθ was eluted another two times by 5 ml of buffer L. The eluted protein was purified to homogeneity using a HiTrap Heparin column (GE Healthcare Life Sciences). The protein was concentrated to 5 mg/ml in a buffer of ammonium acetate (150 mM), KCl (150 mM), tris-HCl buffer (pH 8.0) (40 mM), TCEP (2.5 mM), and glycerol (1% v/v).

Crystallization and structure determination

The crystallization condition was identified by wide matrix screening. Sitting-drop crystallization screening plates were set at 18°C using ARI Crystal Gryphon Robot (ARI) and crystallization screening solutions (Qiagen and Hampton Research). Reacting Polθ (2.5 mg/ml) with a DNA/RNA hybrid (DNA primer: 5′-GCGGCTGTCATT and RNA template: 5′-CGUCCAAUGACAGCCGC) in the presence of ddGTP (1 mM), sucrose monolaurate (300 μM), MgCl2 (1 mM), and spermine tetrahydrochloride (20 mM) prepared the sample for sitting drop vapor diffusion over a 50-μl reservoir containing 20% (w/v) ethanol by mixing 0.3 μl of the reservoir solution with an equal part of the reaction solution. Crystals of approximate final dimensions 20 μm by 20 μm by 20 μm grew over the next 2 weeks. Cryoprotection was achieved by looping the crystals into mother solution with additional 25% (v/v) glycerol before flash cooling into liquid nitrogen. Diffraction data were collected at beamline 23ID-D of the National Institute of General Medical Sciences and National Cancer Institute Structural Biology Facility at the Advanced Photon Source. A complete dataset for Polθ was collected, indexed, integrated, and scaled by the autoprocessing package in APS server (GMCAproc). The Phaser-MR program in the PHENIX package was used for molecular replacement, and COOT was used for model rebuilding and Phenix for simulated annealing and refinement. The structure of Polθ was determined by molecular replacement (MR) using Polθ [Protein Data Bank (PDB): 4x0q] as a search model. The full PDB structure of 4x0q could not yield a solution. An MR solution was only obtained by removing some of the loops and deleting the DNA/DNA duplex from the model. The initial phases of the MR protein model were improved by cyclic model building and refinement, which allow us to slowly build in the missing loops, refolded and reoriented finger and thumb domains, and the DNA/RNA residues on the basis of improved electron density maps. A final model with very good statistics for this resolution range of 3.2 Å has been achieved (table S1).

Nucleic acids

The following nucleic acids were purchased from Integrated DNA Technologies (listed as 5′-3′ polarity):


Access options

Get full journal access for 1 year

All prices are NET prices.
VAT will be added later in the checkout.
Tax calculation will be finalised during checkout.

Get time limited or full article access on ReadCube.

All prices are NET prices.


RNA Polymerase Function

RNA polymerase is the most important enzyme in the process of transcription. Remember that transcription is the process of copying the double-stranded DNA into a single strand of RNA. They may look slightly different, but they are both written in the language of nucleotides. In order for RNA polymerase to begin its work, it must first find an appropriate promoter region. This region can be targeted by transcription factors in eukaryotes. These proteins bind to the site, creating a suitable arrangement for RNA polymerase to bind and start transcription. In bacteria, there is only a single promoter, the sigma initiation factor. This process can be seen with the generalized RNA polymerize molecule shown below transcribing DNA. The transcription factors are not shown.

As RNA polymerase binds to the DNA, it changes conformation, or shape. This starts the enzymatic chain reaction which grows a new chain of nucleotides into an RNA molecule based off of the template presented. After RNA polymerase has created this new molecule, the RNA must be processed and released from the nucleus. Now called messenger RNA, or mRNA, it will encounter a ribosome which has the appropriate mechanisms for the process of translation.

Much like translating English to Spanish, the ribosome must “read” the sequence of the RNA and convert the message into the language of amino acids. These small molecules form long chains, which fold into intricate shapes to become biochemically active proteins. These proteins, in turn, create and maintain parts of the DNA, as well as replicate the DNA. Parts of the DNA store the genetic information for the RNA polymerase protein itself, which is first decoded by an RNA polymerase molecule. This situation is really the basis of the chicken and the egg if you think about it.


Data availability

  1. Adams PD
  2. Afonine PV
  3. Bunkóczi G
  4. Chen VB
  5. Davis IW
  6. Echols N
  7. Headd JJ
  8. Hung LW
  9. Kapral GJ
  10. Grosse-Kunstleve RW
  11. McCoy AJ
  12. Moriarty NW
  13. Oeffner R
  14. Read RJ
  15. Richardson DC
  16. Richardson JS
  17. Terwilliger TC
  18. Zwart PH
  1. Owczarzy R
  2. Tataurov AV
  3. Wu Y
  4. Manthey JA
  5. McQuisten KA
  6. Almabrazi HG
  7. Pedersen KF
  8. Lin Y
  9. Garretson J
  10. McEntaggart NO
  11. Sailor CA
  12. Dawson RB
  13. Peek AS
  1. Schutz P
  2. Karlberg T
  3. van den Berg S
  4. Collins R
  5. Lehtio L
  6. Hogbom M
  7. Holmberg-Schiavone L
  8. Tempel W
  9. Park HW
  10. Hammarström M
  11. Moche M
  12. Thorsell AG
  13. Schüler H

<p>This section provides any useful information about the protein, mostly biological knowledge.<p><a href='/help/function_section' target='_top'>More. </a></p> Function i

RNA-dependent RNA polymerase replicates the viral genome composed of 2 RNA segments, RNA1 and RNA2.

<p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More. </a></p> Manual assertion based on experiment in i


Transcription / RNA Synthesis

mRNA is formed with the help of the codes of the DNA.

Explanation:

Formation of RNA from codes written on DNA is known as transcription, where DNA double helix unzips and unwinds.

Then there are free ribonucleotides which pair up with the complementary bases of one of the exposed DNA strand.

The sugar and phosphate of the neighbouring ribonucleotides keep joining and sugar phosphate backbone of RNA is formed. This pairing up of complementary ribonucleotides along bases of DNA strand is monitored by RNA polymerase , an enzyme.

()

As at the end of this pairing up process, a new single stranded RNA is formed. The newly formed RNA may undergo processing and will later be used for protein synthesis, i.e. translation.

The video below provides a summary of how the processes of transcription and translation occur using the Shockwave tutorial DNA Workshop from PBS.

Answer:

Explanation:

There are many details of both that you can delve into on wikipedia, but the main difference is:

DNA Replication makes two new double strand DNA molecules from an original double strand DNA molecule (semi-conservative replication).

Transcription makes a single strand of RNA off of the DNA double strand (uses one strand of the DNA as a template and makes a single strand of RNA).

Answer:

Transcription is the process where mRNA (Messenger RNA) is made.

Explanation:

Here are the steps of transcription.

DNA is unzipped by the "Helicase" enzyme.

RNA polymerase adds RNA nucleotides to the new RNA strand. (In RNA, thymine is replaced by uracil.)

mRNA is complete when it reaches a stop code on DNA.

mRNA then leaves the nucleus and carries the code to the sites of protein synthesis in the cytoplasm. (DNA never leaves the nucleus.)


Watch the video: DNA Helicase structure and function.flv (May 2022).