Information

Is the occurrence of a particular enzyme in a given subcellular location a random phenomenon?

Is the occurrence of a particular enzyme in a given subcellular location a random phenomenon?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Enzymes occur in different subcellular locations. Some are specific to a given subcellular location, whereas others are heterogeneously distributed. What evolutionary decisions influence the occurence of enzymes in particular compartments?. Are the locations species-specific?


There are various methods for targetting proteins to subcellular organelles or membrane locations. In general they depend on 'tagging' or 'signal' sequences in the proteins. Such tags or signals are recognized by specialized proteins that are able to conduct the protein through the membrane barrier to the particular location.

The individual processes for different target locations vary, so I do not think it appropriate to provide details here. You can read a summary of them in this Wikipedia article. For more extensive treatment you can look at the relevant chapters in Lodish et al. or in Alberts et al. on-line (old edition).

(Please consider donating to Wikipedia, if you use it.)


Prediction of subcellular location apoptosis proteins with ensemble classifier and feature selection

Apoptosis proteins have a central role in the development and the homeostasis of an organism. These proteins are very important for understanding the mechanism of programmed cell death. The function of an apoptosis protein is closely related to its subcellular location. It is crucial to develop powerful tools to predict apoptosis protein locations for rapidly increasing gap between the number of known structural proteins and the number of known sequences in protein databank. In this study, amino acids pair compositions with different spaces are used to construct feature sets for representing sample of protein feature selection approach based on binary particle swarm optimization, which is applied to extract effective feature. Ensemble classifier is used as prediction engine, of which the basic classifier is the fuzzy K-nearest neighbor. Each basic classifier is trained with different feature sets. Two datasets often used in prior works are selected to validate the performance of proposed approach. The results obtained by jackknife test are quite encouraging, indicating that the proposed method might become a potentially useful tool for subcellular location of apoptosis protein, or at least can play a complimentary role to the existing methods in the relevant areas. The supplement information and software written in Matlab are available by contacting the corresponding author.

This is a preview of subscription content, access via your institution.


Convergent Evolution of Enzyme Active Sites Is not a Rare Phenomenon

Since convergent evolution of enzyme active sites was first identified in serine proteases, other individual instances of this phenomenon have been documented. However, a systematic analysis assessing the frequency of this phenomenon across enzyme space is still lacking. This work uses the Query3d structural comparison algorithm to integrate for the first time detailed knowledge about catalytic residues, available through the Catalytic Site Atlas (CSA), with the evolutionary information provided by the Structural Classification of Proteins (SCOP) database.

This study considers two modes of convergent evolution: (i) mechanistic analogues which are enzymes that use the same mechanism to perform related, but possibly different, reactions (considered here as sharing the first three digits of the EC number) and (ii) transformational analogues which catalyse exactly the same reaction (identical EC numbers), but may use different mechanisms.

Mechanistic analogues were identified in 15% (26 out of 169) of the three-digit EC groups considered, showing that this phenomenon is not rare. Furthermore 11 of these groups also contain transformational analogues. The catalytic triad is the most widespread active site the results of the structural comparison show that this mechanism, or variations thereof, is present in 23 superfamilies.

Transformational analogues were identified for 45 of the 951 four-digit EC numbers present within the CSA and about half of these were also mechanistic analogues exhibiting convergence of their active sites. This analysis has also been extended to the whole Protein Data Bank to provide a complete and manually curated list of the all the transformational analogues whose structure is classified in SCOP.

The results of this work show that the phenomenon of convergent evolution is not rare, especially when considering large enzymatic families.


Fluorescence Microscopy and Random Protein Tagging

Subcellular location can be experimentally determined by subcellular fractionation, electron microscopy or fluorescence microscopy. The last is the most common method and relies on the ability to deliver fluorescent molecules into cells to label specific proteins. There are two ways of doing this.

The first method, immunofluorescence microscopy, relies on delivering external fluorescent molecules into cells. Cells are first fixed by adding a substance (e.g. paraformaldehyde) that cross-links proteins in the cell, essentially immobilizing all cellular components. This prevents the contents of the cells from washing away when the cells are next permeabilized, meaning that a detergent is used to fully or partially dissolve the cell membrane. With the membrane barrier out of the way it is possible to introduce any desired molecules into the cell, for example antibodies conjugated to fluorescent dyes. An alternative to using antibodies is to use other specific substances known to bind to a particular protein. For example phalloidin binds to F-actin, a major component of the cytoskeleton. Therefore dye-conjugated phalloidin can be used to label the actin cytoskeleton. The use of such probes is not strictly immunofluorescence, but is functionally identical. One limitation of immunofluorescent labeling is the dependence on the existence of specific antibodies or probes that are known to bind to the target protein. Another is that, due to the need for fixation and permeabilization, it cannot be used with live cells.

The second method is to have fluorescent molecules be internally generated in the cells of interest. DNA sequences coding for a fluorescent protein (e.g., eGFP) can be engineered so that they will be randomly attached to an endogenous protein in the cell, thereby fluorescently labeling that protein. There have been several examples of the use of this technique (12�). This method does not depend on the existence of antibodies or probes that bind to the target protein, because with these approaches a random protein is tagged. Random-tagging of proteins can also be done with the use of small epitopes (essentially short sections of a protein) instead of fluorescent proteins (16,17). In this case immunofluorescence is used to image the location of the tagged protein, using an antibody against the epitope tag. This has the advantage that epitope tags are frequently much smaller than fluorescent proteins and are therefore less likely to disrupt the function of the protein they are attached to. On the other hand the fixing and staining that are required for immunofluorescence can disrupt cellular structures, and it means that live cells cannot be imaged.

When random-tagging experiments are repeated enough, one can eventually label most (or possibly all) proteins in a given cell type. This method combined with fluorescence microscopy allows comprehensive libraries of images depicting the location patterns of proteins in a given cell type to be generated.


Results

Antibody specificity with respect to PfSHMTc and PfSHMTm

The pfshmt gene from P. falciparum (PFL1720w) [41] encodes a product that has been functionally characterized as a conventional cytoplasmic SHMT [21–23]. However, a predicted SHMT-like gene product (PfSHMTm, encoded on PF14_ 0534) was also identified that carries a putative mitochondrial signal sequence [24] with 18% amino acid identity and 44% similarity to PfSHMTc, but lacks almost all (16 of 21) of the known, very highly conserved residues [42] contributing to the active site in SHMT orthologues from other organisms, whether cytoplasmic or organellar (See Additional file 2 Sequence alignments of the PfSHMT isoforms). Despite the relatively low level of identity, it was essential to establish the specificity of the anti-PfSHMTc and anti-PfSHMTm antibodies that had been raised to be certain of the identity of the protein yielding positive signals. Both full-length open reading frames were therefore cloned in Escherichia coli expression systems and equal amounts of protein products processed for western blotting. The anti-PfSHMTc antibody recognized the heterologously expressed cognate protein (Figure 1B) and blots of total parasite lysates from two lines, K1 and 3D7, showed a single band also at the predicted size (49.8 kDa) for the full length PfSHMTc protein (Figure 1D). Importantly, there was no evidence for cross-reaction with the PfSHMTm product of PF14_0534 (Figure 1B), whereas control anti-His-tag antibodies recognized both recombinant products essentially equally (Figure 1A). This engendered confidence that subsequent immunofluorescence signals using the cognate antibody arose solely from PfSHMTc. In the case of PfSHMTm, this antibody was raised to the whole protein (unlike the anti-PfSHMTc antibody), some cross-reaction with PfSHMTc was not unexpected and was evident on blots against recombinant protein. However, this was approximately fourfold less intense than that seen in recognising the cognate PfSHMTm protein (Figure 1C). Against parasite extracts, the anti-PfSHMTm antibodies gave a predominant band with the same mobility as the recombinant protein (Figure 1E). It was noted on all blots that PfSHMTm ran slightly ahead of PfSHMTc, despite its somewhat higher predicted molecular weight (55.2 kDa). These differences in specificity led us to conclude that the differences seen below in immunofluorescence images of parasites probed with anti-PfSHMTc from those produced using anti-PfSHMTm are a reliable indicator of biologically significant variations in the distribution of the respective target proteins.

Specificity of the polyclonal anti-PfSHMT preparations. Full-length His-tagged recombinant protein (500 ng) expressed from the genes encoding PfSHMTc (PFL1720w) and PfSHMTm (Pf14_0534) probed on western blots with (A) anti-polyhistidine IgG, (B) the anti-PfSHMTc and (C) the anti-PfSHMTm preparations used for subsequent immunofluorescence studies. Panels D and E are western blots of total parasite extracts from K1 and 3D7 probed with anti-PfSHMTc (D) and anti-PfSHMTm (E). Rc, recombinant PfSHMTc Rm, recombinant PfSHMTm M, prestained molecular weight markers.

Cytoplasmic distribution of the PfSHMT isoforms

SHMT subcellular distribution in a number of organisms shows a partition between cytoplasmic SHMT and distinct isoforms of the enzyme located within organelles. As only PfSHMTc has thus far been confirmed as enzymatically active in P. falciparum[21–23], a single cellular location might be predicted. However, initial probing using its cognate antibody showed that PfSHMTc does not follow such a simple distribution pattern during the erythrocytic cycle. All stages showed an expected generalized cytoplasmic staining and this, by visual examination and volumetric analysis by the Imaris software, is where the majority of the PfSHMTc molecules are located for most of the time. However, fluorescence brightness within the cytoplasm was not uniform and constriction of cytoplasm between organelles, especially nuclei, produced a patchy appearance (Figure 2). The PfSHMTm protein (Figure 3) showed an almost identical cytoplasmic distribution to that described for the PfSHMTc enzyme, as can also be seen in Figure 4, 5, 6, 7, 8 and 9, in which the anti-PfSHMTc and anti-PfSHMTm antibodies are used in various combinations with organellar labels. However, images obtained where both antibodies were used in combination did show some minor differentiation in cytoplasmic localization and relative concentration within individual parasites, exemplified by Figure 5C, D and 5F.

PfSHMTc immunofluorescence images showing localization in the mitochondrion. (A) Mid-trophozoite showing the association of a small mitochondrion with PfSHMTc fluorescence. (B) Early schizont showing association of an enlarged globular mitochondrion with a region of more intense PfSHMTc fluorescence. (C) Late schizont showing very little co-localization of mitochondria with areas of PfSHMTc fluorescence. Mitochondria are closely aligned to nuclei and show some co-localization with YOYO1 staining (scale bars 3 μm). The associated table shows the percentage volume (V%) and material (M%) co-localization data for PfSHMTc (Sc) and MitoTracker (MIT) fluorescence.

PfSHMTm immunofluorescence images showing localization in the mitochondrion. (A) Two late trophozoites. (B-D) Mitotic schizonts. (E) Post-mitotic schizont. The images show the persistence of co-localization of PfSHMTm fluorescence with the mitochondria throughout the developmental cycle (scale bars 3 μm). The associated table shows the percentage volume (V%) and material (M%) co-localization data for PfSHMTm (Sm) and MitoTracker (MIT) fluorescence.

PfSHMTc immunofluorescence images showing localization in the apicoplast. (A) Mid-trophozoite showing the co-localization of plastid specific fluorescence with PfSHMTc fluorescence. (B) Early mitotic schizont showing very marked co-localization of plastid specific fluorescence (enlarged globular apicoplast) with PfSHMTc fluorescence. (C) Mitotic schizont showing very marked co-localization of plastid specific fluorescence with PfSHMTc fluorescence. The plastid here is in the early stages of elongation. Note also the small punctate concentration of PfSHMTc fluorescence on the periphery of the unstained region of the parasite corresponding to the pigment vacuole. (D) Mitotic schizont developmentally a little later than (C) showing a mitochondrion in the early stages of ramification. The area of intense PfSHMTc fluorescence follows the 'Y' shape of the mitochondrion closely (scale bars 3 μm, except (D) which is 2 μm). The associated table shows the percentage volume (V%) and material (M%) co-localization data for PfSHMTc (Sc) and acyl carrier protein (ACP) fluorescence.

Triple-labelling experiments. (A) and (B) Combined mitochondrial and apicoplast images probed with anti-PfSHMTc. These do not show nuclear morphology, therefore the erythrocytic cycle stage cannot be precisely ascertained however, the size of the organelles and overall size of the parasites in (A) and (B) suggest that both are mid trophozoites. In (A) the parasite is probed with anti-PfSHMTc, MitoTracker and anti-ACP (plastid). The plastid is coincident with an area of marked PfSHMTc fluorescence, whereas the mitochondrion shows no evidence of coincident PfSHMTc fluorescence. In (B) the parasite is probed with anti-PfSHMTc, MitoTracker and anti-ACP (plastid). The plastid is coincident with a discrete area of PfSHMTc fluorescence, whereas the mitochondrion is located in a pocket of lower PfSHMTc fluorescence. (C) Parasite is probably a late trophozoite and (D) a mitotic schizont. Both parasites were expressing DsRED-labelled ACP and were probed with both anti-PcSHMTc (IgY) and anti-PfSHMTm (IgG). The distribution of the two SHMT fluorescence signals are similar but not identical, and both co-localize with the apicoplast (scale bars (A) and (C), 3 μm, (B) 2 μm, (D) 4 μm). The associated table shows the percentage volume (V%) and material (M%) co-localization data for PfSHMTc (Sc), PfSHMTm (Sm), MitoTracker (MIT) and acyl carrier protein (ACP) fluorescence.

PfSHMTm immunofluorescence images showing localization in the apicoplast. (A) Early trophozoite showing no apicoplast PfSHMTm co-localization. (B) Early mitotic schizont with PfSHMTm fluorescence conforming closely to the 'C' shaped apicoplast. (C) Mitotic schizont with an elongating apicoplast, PfSHMTm fluorescence is concentrated within the distal portions of the organelle with little fluorescence in the medial section. (D) Post-mitotic schizont showing little spatial coincidence of PfSHMTm and the multiple apicoplasts (scale bars 3 μm, except (D). which is 2 μm). The associated table shows the percentage volume (V%) and material (M%) co-localization data for PfSHMTm (Sm) and acyl carrier protein (ACP) fluorescence.

PfSHMTm apicoplast immunofluorescent images illustrating the concentration of fluorescence in the extremities of elongating apicoplasts. (A) Mitotic schizont with an elongating apicoplast. (B) A z-stack series with an interval of 0.2 μm through the same parasite showing the concentration of PfSHMTm fluorescence in the distal portions of the apicoplast and the relative lack of PfSHMTm fluorescence in its medial section (scale bars 2 μm).

Positive control images using endogenously expressed DsRED-tagged ACP instead of anti-ACP antibodies. The use of only one primary antibody, anti-PfSHMTc, with expressed DsRED tagged Pf ACP, was aimed at eliminating any possibility of artifactual fluorescence arising from interactions between two primary antibodies used simultaneously. (A) Two parasites, upper parasite is undergoing its first division, lower parasite is a late trophozoite. (B) Mitotic schizont with elongating apicoplast. (C) Mitotic schizont with ramifying apicoplast. All parasites show co-localization of anti-PfSHMTc fluorescence with the apicoplast, closely following the shape of the organelle, identical results to those obtained using two primary antibodies (scale bars (A) and (C) 3 μm, (B) 2 μm).

Late schizonts show a central concentration of PfSHMTc fluorescence. (A) Post-mitotic schizont showing a concentration of PfSHMTc fluorescence in the centre of the parasite, and overlapping the outer zone of haemozoin. PfSHMTc is largely excluded from the nuclei. (B) Post-mitotic schizont showing a concentration of PfSHMTc fluorescence in the centre of the parasite as well as at low intensity in the multiple small apicoplasts. Note the merozoite buds arranged in a radial pattern centred on the future residual body. (C) A post-mitotic parasite probed with both anti-PfSHMTc (IgY) and anti-PfSHMTm (IgG). Both SHMT proteins show a similar, but not identical distribution, as described for image series (A) and (B) above (scale bars 3 μm).

Mitochondrial localization of PfSHMTc

The mitochondrion and the apicoplast undergo a similar, though not simultaneous, morphological evolution during the development of erythrocytic stage parasites. The two organelles are found in close physical association and a junction between their respective membranes has been described [43, 44]. The organelles increase in size, and in the case of the K1 isolate used here, were often observed to adopt a globular shape in the early schizont stage thereafter they lengthen and ramify, eventually dividing to allow one of each organelle to associate with each individual developing merozoite [45]. These organelles thus have a requirement for folate pathway metabolites for the synthesis of DNA precursors needed for the replication of their genomes.

The mitochondria, visualized using MitoTracker, showed some evidence of associated PfSHMTc fluorescence throughout the erythrocytic cycle but predominantly during the stages associated with DNA replication. In many early and late parasites, the mitochondria were physically very small and consequently it could not be concluded with any certainty that PfSHMTc fluorescence was within the organelle lumen or merely in the adjacent cytoplasm. Indeed some early to mid-trophozoites showed no evidence of PfSHMTc fluorescence within their mitochondria. However, some mid-trophozoites showed a more convincing co-localization, e.g. Figure 2A, while the larger mitochondria found in very late trophozoites and early schizonts, such as shown in Figure 2B, clearly showed PfSHMTc fluorescence within the lumen, though at a similar concentration to that in the immediately surrounding cytoplasm. Figure 2C is an example of a post-mitotic schizont where very little co-localization remains.

Calculation of the levels of co-localization of PfSHMTc and MitoTracker reinforces this qualitative conclusion. The percentage of PfSHMTc material co-localizing varied between 2.2% and 5.8% (Figure 2) and the percentage volume of PfSHMTc co-localized showed only a similar, or slightly higher, value in comparison, confirming that the mitochondrion does not accumulate a noticeably higher concentration of PfSHMTc than that found in the cytoplasm. The three-dimensional projection within Figure 2C gives a particularly good view of a post-mitotic schizont showing the close spatial connection between the nuclei and mitochondria destined to occupy the same daughter merozoite. However, the mitochondria in this late stage parasite showed little evidence of PfSHMTc staining.

Mitochondrial localization of PfSHMTm

The use of anti-PfSHMTm revealed a different pattern of mitochondrial co-localization. The PfSHMTm protein, in contrast to PfSHMTc, was found strongly associated with the mitochondria throughout the erythrocytic cycle, from early trophozoites to late, post-mitotic, schizonts. The mitochondrion was always found within regions of relatively high intensity PfSHMTm fluorescence (Figure 3A and 3E) and in many instances the shape of the PfSHMTm fluorescence conformed to the shape of mitochondria (Figure 3B, C and 3D). Importantly, there were no instances of scanned images where mitochondria were found without associated PfSHMTm fluorescence or where such fluorescence was visibly lower than that of the adjacent cytoplasm. However, the quantitative analysis for Figure 3 gave very similar figures for percentage PfSHMTm material co-localized with the MitoTracker compared with percentage volume co-localized, suggesting that there was no active accumulation of PfSHMTm within the mitochondria above the levels in the cytoplasm. The percentages of PfSHMTm material co-localized with MitoTracker varied between 5.0% and 12.9%, a higher range of values than measured for PfSHMTc (2.2 - 5.8%).

Apicoplast localization of PfSHMTc

In contrast to the relatively weak spatial association between subcellular PfSHMTc distribution and the mitochondrion, the apicoplast exhibited a distinctly more pronounced relationship. The apicoplast was visualized in two ways: using antibodies to acyl carrier protein (anti-ACP), which is apicoplast specific [37, 45] and using a transfected 3D7 line constitutively expressing DsRED-tagged PfACP [39]. The parasite shown in Figure 4A was at the mid-trophozoite stage, and although the apicoplast was still relatively small, PfSHMTc fluorescence was clearly co-localized with anti-ACP, indicating that it was within the lumen of this organelle. The parasites in Figure 4B and 4C are early schizonts, at which stage the apicoplast is considerably larger in absolute volume, as well as relative to overall cell volume. In the K1 isolate used in these images, the apicoplast often assumes first an enlarged globular form, which then elongates before ramifying. All of these parasites showed a bright PfSHMTc fluorescence coincident, or largely coincident, with the anti-ACP fluorescence that defines the position of the apicoplast, with the surrounding general cytoplasmic PfSHMTc fluorescence being perceptibly less bright. The parasite shown in Figure 4B displays the earlier globular apicoplast morphology, the parasite in Figure 4C contains an apicoplast that has started to elongate. The three-dimensional projection of the parasite in Figure 4C also allows a clear visualization of the small punctate concentrations of fluorescence that are suggestive of a vesicle-associated location of PfSHMTc, often seen in close proximity to the haemozoin containing pigment vacuole in trophozoite and early schizont stages. The parasite in Figure 4D shows an apicoplast in the ramifying stage of its development and the correspondence of the anti-PfSHMTc fluorescence to the 'Y' shaped apicoplast is striking. In the 3D7 transfectant expressing PfACP with a DsRED tag, the development of the apicoplast did not exhibit the globular stage often seen in K1 parasites, with narrow ramifying apicoplasts being far more evident (Figure 8B and 8C). However, the close coincidence of the apicoplast and PfSHMTc fluorescence was equally evident as when using K1 and two primary antibodies (see also below).

Quantitative analysis again supports the visual interpretation of the apicoplast data. The trophozoite shown in Figure 4A had a percentage material co-localization of PfSHMTc with anti-ACP of 5.9% and a percentage volume co-localization of 5.8%, indicating that the PfSHMTc fluorescence in this parasite was not appreciably higher within the apicoplast than without. The early schizont stage parasites in Figure 4B and 4C showed significantly higher percentages of PfSHMTc material co-localization of 10.1% and 22.3%, indicating that a considerable proportion of the PfSHMTc of these particular parasites was located within the comparatively small volume of the apicoplast. Moreover, the percentage material co-localized for PfSHMTc fluorescence in these two parasites was about one-third higher than the respective percentage volumes, reinforcing the visual impression that in these parasites PfSHMTc was at a higher concentration within the apicoplast than in the cytoplasm generally. A slightly later parasite (Figure 4D), showing a ramifying apicoplast, displayed a somewhat lower level of co-localization of PfSHMTc with anti-ACP of 4.5% at a concentration that is again no higher than that of the surrounding cytoplasm.

A direct comparison between mitochondrial and apicoplast PfSHMTc concentrations was made in triple staining experiments. In this case, the limitations of wavelengths available precluded using a dye to simultaneously stain the DNA so that the precise stage of the parasites viewed was not clearly discernible however, the size of the organelles and overall size of the parasites suggest that those shown in Figure 5A and 5B are mid-trophozoites. In these experiments, PfSHMTc was stained using Alexafluor anti-chicken IgY 488 nm (false coloured blue), which proved to be especially prone to bleaching and therefore unsuited to the repeated exposure to laser light necessary in building a z-stack scan. Unlike the other images presented here, therefore, those showing both the mitochondrion and the apicoplast are from single plane scans where both organelles were in the same z-axis plane. The parasite in Figure 5A shows apicoplast-specific fluorescence located within a discrete region of bright PfSHMTc fluorescence, whereas in contrast, the mitochondrion appears to have no associated PfSHMTc fluorescence. The parasite in Figure 5B also shows the apicoplast fluorescence within a region of high PfSHMTc fluorescence whilst the mitochondrion occupies a pocket of lower intensity PfSHMTc fluorescence. Quantitative analysis confirmed the much more substantial association of PfSHMTc with the apicoplast than with the mitochondrion. As these figures refer to pixels in a single plane rather than voxels in a three-dimensional projection from a z-stack scan, extrapolation to volumetric values was unsafe in this particular case.

Apicoplast localization of PfSHMTm

Use of anti-PfSHMTm in conjunction with anti-ACP showed that the PfSHMTm protein was also found within the apicoplast. The temporal distribution of PfSHMTm within the apicoplast through the erythrocytic cycle was qualitatively similar to that of PfSHMTc. Thus, there was no discernible co-localization seen in the early trophozoite (Figure 6A), however, there was a marked presence of PfSHMTm fluorescence within the apicoplasts of both late trophozoites and mitotic schizonts (Figure 6B and 6C, Figure 7 see also Figure 10). The later, post-mitotic, schizonts showed a similar lowering of apicoplast-associated PfSHMTm fluorescence to that found using the PfSHMTc specific antibody (Figure 6D). However, the spatial distribution of the PfSHMTm fluorescence within the elongating apicoplasts of early schizonts was, in contrast, dissimilar to that shown by PfSHMTc. Whereas the latter exhibited fluorescence relatively uniformly across the apicoplasts (Figure 4C and 4D Figure 8B and 8C), PfSHMTm was distinctly concentrated in their extremities, and was notably absent, or in very much lower concentration, within the medial sections of these organelles (Figure 6C). This phenomenon is further illustrated by the sequential z plane views (at 0.2 μm intervals) through the same parasite shown in Figure 7B, especially in the second panel of this sequence, which clearly shows concentration of PfSHMTm fluorescence at the tips, and the fourth and fifth panels, where the lower degree of staining of the medial regions relative to the tips is apparent. The percentage co-localization of anti-PfSHMTm material with anti-ACP fluorescence was indicative of a low level of apicoplast PfSHMTm concentration in the trophozoite, e.g. 1.0% for Figure 6A, followed by much higher apicoplast PfSHMTm concentrations in the mitotically active schizont: e.g. 11.3% for Figure 6B, 11.8% for Figure 7A and 36.3% for Figure 6C. In the later, post-mitotic, schizonts, levels of co-localization fell back to lower values, the parasite shown in Figure 6D having a percentage of PfSHMTm material co-localizing with anti-ACP of only 0.3%.

Organellar distribution of fluorescence through the erythrocytic cycle. Percentages of parasites (of the total number scanned for each stage) showing marked fluorescence for PfSHMTc (c) and PfSHMTm (m) in the mitochondrion (mit) and apicoplast (api). ET, early trophozoites LT, late trophozoites MS, mitotic schizonts PMS, post-mitotic schizonts. For organellar localization of PfSHMTc, n = 82 for that of PfSHMTm, n = 76.

Imaging using an endogenously expressed apicoplast marker

The simultaneous use of two primary antibodies, even when raised in different species, combined with their respective fluorochrome-conjugated secondary antibodies, raised the formal possibility that any observed co-localization was the result of fortuitous interactions between those antibodies. To eliminate this possibility, 3D7 transfected parasites expressing the apicoplast-specific protein ACP fused to the DsRED reporter were employed [39]. When these parasites were probed with the single anti-PfSHMTc antibody, the images obtained showed an identical incidence of co-localization of the PfSHMTc fluorescence with the apicoplast (Figure 8A-C) as was seen using the two antibody approach above, although the relatively low absolute brightness of the DsRED fluorescence made these images unsuited to quantitative evaluation. The conclusion from this result is that the images created using two primary antibodies are a true reflection of the sub-cellular distribution of the proteins investigated and that the same distribution is found in two independent lines of the parasite, K1 and 3D7.

The parasites expressing PfACP-DsRED were also simultaneously probed with antibodies to both PfSHMTc (IgY) and PfSHMTm (IgG), again employing single plane scans without a DNA-specific dye rather than z-stacks for this triple labelling experiment. The parasite in Figure 5C (estimated to be a mid to late trophozoite), and that in Figure 5D (an early schizont) both show overlapping, though not identical, PfSHMTc and PfSHMTm fluorescence distribution in the cytoplasm. Both parasites show PfSHMTc and PfSHMTm coincident with the apicoplast as indicated by white colouration in the relevant merged image. Quantitative image analysis reinforces the visual indication of co-localization of both PfSHMTc and PfSHMTm with each other, and with the apicoplast specific fluorescence. In particular the apicoplast specific fluorescence was almost entirely (between 82.8% and 99.7%,) co-localized with the signals from both isoforms of SHMT.

SHMT distribution in the post-mitotic schizont

In late, post-mitotic, schizonts, PfSHMTc fluorescence was characterized by a concentration in the central portion of the parasite. The peripheral regions of the parasite occupied by the nuclei and other constituents of the developing merozoites contained conspicuously lower levels of fluorescence, as shown in Figure 9A and 9B. The central area of late schizonts is the region that becomes the residual body upon completion of merozoite maturation and lysis of the erythrocyte, a prominent component of which is the pigment vacuole containing the crystalline haemozoin. In the very late schizont when the majority of the haemoglobin has been digested, the pigment vacuole occupies a large volume. Figure 9A and 9B show the central mass of dense haemozoin exhibiting no PfSHMTc staining but with marked PfSHMTc fluorescence in the region immediately surrounding it. To assess the relative frequency of this category of PfSHMTc distribution, 48 scans of post-mitotic schizonts were viewed, of which 15 showed a marked concentration of fluorescence in the centre of the schizont when compared to their periphery, an incidence of 31%. The use of anti-PfSHMTm antibody in conjunction with anti-PfSHMTc showed that PfSHMTm has a very similar concentration within the central region of the very late schizont (Figure 9C). Additional to this general distribution pattern, the post-mitotic schizont contains numerous small apicoplasts, each associated with a developing merozoite. Despite the diminutive size of these organelles, the persistence of PfSHMTc fluorescence within the 'daughter' apicoplasts was still discernible in some images, e.g. in Figure 9B, where the lower right plastid in the parasite clearly shows its presence. The three-dimensional projection shown in Figure 9B is interesting as it shows a relatively late stage of daughter merozoite biogenesis.

Nuclear localization

In most parasites viewed there was a distinctly lower PfSHMTc fluorescence within nuclei than was found in the cytoplasm. However, PfSHMTc fluorescence was very rarely entirely excluded from the nucleus (see especially Figure 4C and 4D Figure 9B and 9C). The level of nuclear relative to cytoplasmic fluorescence was variable with higher levels of intranuclear PfSHMTc fluorescence seen in some late trophozoites and mitotic schizonts. Nuclear PfSHMTc fluorescence rarely approached the intensity of cytoplasmic fluorescence, however. In contrast, PfSHMTm showed very little evidence of nuclear localization throughout the erythrocytic cycle, with most images showing an essentially complete exclusion of PfSHMTm fluorescence from nuclei (Figure 3D and 3E Figure 6A, C and 6D).

Relative incidence of organellar SHMT fluorescence through the erythrocytic cycle

In view of the initially surprising results that PfSHMTc showed organellar co-localization patterns, a large number of z-axis scans of parasites were analysed in order to ascertain the relative incidence of organellar fluorescence for this isoform over the erythrocytic cycle. Parasites were assigned to one of four broadly defined developmental stages by examination of overall size, haemozoin development and nuclear morphology (Figure 10). These results emphasize the stage-specific dependence of organellar PfSHMTc fluorescence, which was undetectable in parasites up to and including the early trophozoite stages, visible from mid-trophozoites onward and peaking at the mitotic schizont stages. The corresponding analysis for PfSHMTm with respect to the mitochondrion is strikingly different in that 100% of parasites showed fluorescence in this organelle, regardless of the cell cycle stage. However, its incidence in the apicoplast was similar to that of PfSHMTc, in that it was not seen in the early trophozoite stage but peaked in the late trophozoite stage, although the percentage of parasites displaying this pattern was significantly higher than was the case for PfSHMTc.

GFP-tagging of SHMT via transfection

To support the immunofluorescence studies in a complementary manner, independent attempts were made in the two collaborating laboratories to produce transfected parasites expressing GFP-tagged, full length PfSHMTc and PfSHMTm endogenously, as well as shorter versions carrying a GFP-tag downstream of the first 100 amino acids of each protein (i.e. about one-quarter of their total length). Despite repeated transfections using several different protocols for these four constructs, viable parasites could only ever be recovered in the case of the truncated version of PfSHMTm + GFP. Fluorescence microscopy clearly located this hybrid protein in the mitochondrion (Figure 11), confirming the initial prediction based on sequence analysis that PfSHMTm carries a mitochondrial targeting signal at its N-terminus [24]. However, in contrast to the studies above using the anti-PfSHMTm antibody, no additional distribution in the cytoplasm or apicoplast was apparent, suggesting that localization to these areas was dependent upon properties of the full-length molecule.

GFP-tagging of truncated PfSHMTm in transfected 3D7 parasites. Fluorescence images of parasites transfected to yield a GFP-fusion carrying the first 100 amino acids of PfSHMTm at the N-terminus. MitoTracker was also used to localize the mitochondrion, which showed complete coincidence with the GFP fluorescence (three examples shown).

Transcript analysis of PfSHMTc

In the original characterization of the gene encoding PfSHMTc, comparison of cDNA and genomic sequences, together with RACE analyses of the transcript start point in two independent laboratories [8, 21], identified only a

240 base 5' UTR on the mRNA which lacked any AUG motif upstream of the documented start codon. To confirm and extend this result, we carried out RT-PCR experiments using a range of internal primers based on genomic sequence extending up to 1 kb upstream of the start codon. However, no splice variants were detected (data not shown), nor could any putative splicing event using the normal GU and AG intron junction signals within this sequence create an alternative start codon. Thus there was no evidence that PfSHMTc might employ a conventional signal sequence that had previously been overlooked to gain access to the organellar compartments.


4 In Situ Capturing Technologies

The spatial techniques described so far have been based on either isolation of already-known tissue regions of interest, or in situ visualization of RNA molecules by hybridization or sequencing. Another approach is to capture transcripts in situ, then perform sequencing ex situ. The concept is attractive since it avoids the typical limitations of direct visualization and allows for an unbiased analysis of the complete transcriptome. However, the main hurdle for these methods is restricted RNA capture efficiency, which becomes increasingly more challenging with higher resolution (i.e., smaller capture/barcoded areas). An overview of in situ capturing technologies mentioned here is shown in Figure 5.

4.1 Spatial Transcriptomics

The first technique employing this approach was the Spatial Transcriptomics (ST) technology, published in 2016. [ 41 ] Thin tissue sections are placed onto glass slides which are printed with barcoded RT primer, specifying the x and y coordinates of the array. The tissue is fixed, stained, imaged, and permeabilized. During the permeabilization process, mRNA molecules diffuse vertically down to the solid surface and hybridize locally to the RT primers. RT is performed in situ, after which the tissue is removed, and the cDNA-mRNA complexes are extracted for library preparation and next generation sequencing (NGS) readout. The barcoded reads are superimposed back onto the tissue image. Although the method gives you spatially resolved whole-transcriptome information, the current barcoded regions of 100 µm in diameter, limits the resolution to ≈10–40 cells. At the end of 2018, the ST technology was acquired and further developed by the company 10X Genomics, under the name “10X Visium.” [ 42 ] The 10X Visium assay displays improvements in both resolution (55 µm in diameter and smaller distance between barcoded regions) as well as time to run the protocol. At the moment, both the ST and 10X Visium assays are only offering 3′ cDNA count data.

4.2 Slide-Seq

Instead of printing regional barcoded RT primers onto a glass slide, one could instead attach them onto beads in solution and then dispense them on a glass surface. This approach was taken by the research team behind the Slide-seq technology in 2019, [ 43 ] where barcoded 10 µm in diameter beads are randomly monolayered-packed onto a glass coverslip. Since the positions of the beads are not known beforehand, the beads barcode needs to be decoded in situ by using SBL prior to the sample preparation procedure. The experimental procedure is conceptually similar to the ST method, where permeabilization of the tissue section lets the mRNA within diffuse vertically downward to the barcoded beads on the surface. The method holds a resolution analogous to the size of a single cell, but in order to properly map spatially localized cell types, the sensitivity limitation of the current version implies that support by scRNA-seq data is needed. Of note is that, compared to the other in situ methods, the tissue image is obtained from an adjacent section and not from the same as the RNA data is acquired from. The impact of this will depend in large on the sample type and the biological question at hand. While tissue with highly conserved morphological structure (e.g., regions of the mouse brain) will display very high similarity across adjacent sections, samples with less structure and high degree of heterogeneity (e.g., within a tumor) will aggravate the interpretation.

4.3 High-Definition Spatial Transcriptomics

Shortly after the Slide-seq approach was published, another method using even smaller barcoded beads was announced, named high-definition spatial transcriptomics (HDST). [ 44 ] Here, they randomly deposit 2 µm-sized beads containing barcoded RT primers onto an ordered bead array. As well as with Slide-seq, the beads location on the array needs to be decoded before the sample preparation procedure begins, which is done by several rounds of hybridizations. Since the spatially resolved HDST data is currently very sparse, neighboring beads covering circular areas with a diameter of ≈13 µm is binned in order to enhance the read depth per region. Like for Slide-Seq, the lack of capture sensitivity demands scRNA-seq data to assist mapping of spatially localized cell types.

4.4 Nanostring GeoMx Digital Spatial Profiler

In March of 2019, NanoString announced the commercial launch of the GeoMx Digital Spatial Profiling instrument. [ 45 ] GeoMx differentiate itself by its ability to work on notoriously difficult FFPE samples. The instrument also has the ability to spatially profile proteins, although not on the same tissue section. It works in an iterative manner, where the user manually selects regions of interest (ROIs) via microscopy of varying sizes (10–600 µm in diameter). These regions are then excited with UV light, triggering the release of either RNA target probe (mRNA assay) or antibody (protein assay) coupled barcoded tags. In the current commercial form, the tags are collected and quantified with the NanoString nCounter instrument, putting a limit to multiplex capacity. However, NGS readout is demonstrated in a preprint, [ 46 ] in which the authors state that this type of readout has the potential for an unlimited multiplex capacity. While in theory the chemistry and the combinatorial approach might allow for such a statement, this capacity has not yet been demonstrated. The workflow of selecting ROIs, although largely automated, makes it infeasible to analyze whole tissue sections and therefore unbiased regional analysis could become difficult. While the shape and size of the ROI can be adjusted, the smallest available size of 10 µm (approximately the size of a single-cell), suffers from low protein detection efficiency, [ 47 ] and the same resolution on RNA level has not yet been demonstrated.

4.5 APEX-Seq

In situ capturing technologies described so far target the spatial landscape of anatomical regions within intact tissue sections. However, there are also approaches for profiling subcellular localizations of endogenous RNAs within individual living cells. Two recent publications showing how the specific locations of RNAs within living cells is bound to their cellular functions, used the APEX-Seq method. [ 48, 49 ] In APEX-Seq, one uses cell lines recombinantly expressing the enzyme APEX2 in specific subcellular regions of interest. By incubating the live cells in biotin-phenol and hydrogen peroxide, the APEX2 enzyme will tag nearby RNAs with biotin, which can then be isolated using streptavidin beads and subjected to RNA-seq. Whole-transcriptome profiles within individual cellular domains can therefore be assessed from living cells. As APEX-Seq requires recombinant technology, the methods not applicable to normal tissues.

4.6 Microfluidic Barcoding in Tissue Sections

A spatial method that attempts to combine spatially resolved mRNA and protein expression on the same tissue section, utilizing microfluidics and imaging, was recently presented in a preprint. [ 50 ] This method, named microfluidic Deterministic Barcoding in Tissue for spatial omics sequencing (DBiT-seq), is performed by first placing a microfluidics chip containing multiple parallel channels on top of a tissue section. For each channel, oligo-dT-tagged barcodes and/or antibody-tagged barcodes are streamed over the tissue. Next, the first chip is removed, and a second microfluidic chip is put on top of the tissue, but this time it is turned in a 90° angle to the first flow direction. New barcodes are now streamed through the parallel channels, resulting in a mosaic of 10 µm sided rectangles of the tissue, containing combined barcodes from the first and the second stream.


Is the occurrence of a particular enzyme in a given subcellular location a random phenomenon? - Biology

a Key Laboratory for Molecular Enzymology and Engineering of Ministry of Education, School of Life Science, Jilin University, 2699 Qianjin Street, Changchun 130012, China
E-mail: [email protected]

b Department of Pathobiology, College of Basic Medical Sciences, Jilin University, Changchun, China
E-mail: [email protected]

Abstract

Adenosine deaminase (ADA) is an important enzyme related to purine nucleoside metabolism in human serum and various tissues. Abnormal ADA levels are related to a wide variety of diseases such as rheumatoid arthritis, AIDS, anemia, lymphoma, and leukemia and ADA is considered as a useful target for various diseases. Currently, ADA can be divided into open conformation and closed conformation according to the inhibitors of binding. As a consequence, we chose two inhibitors, namely, 6-hydroxy-1,6-dihydro purine nucleoside (PRH) and N-[4,5-bis(4-hydroxyphenyl)-1,3-thiazol-2-yl]hexanamide (FRK) to bind to ADA in the closed conformation or open conformation respectively. In this study, we performed the random acceleration molecular dynamics (RAMD) method, steered molecular dynamics (SMD) simulations and adaptive basing force (ABF) simulation to explore the unbinding tunnels and tunnel characteristics of the two inhibitors in ADA. Our results showed that PRH and FRK escaped from ADA using three main tunnels (namely, T1, T2, and T3). Inhibitors (PRH and FRK) escape through T3 more frequently and more easily. The results from ABF simulations confirm that the free energy barrier in T1 or T2 is larger than that in T3 when inhibitors dissociate from the ADA and have potential mean of force (PMF) depth. Moreover, in the complexes (ADA-PRH, ADA-FRK), we also found that the most active residue that remarkably contributed to the binding affinity is W117 in T3, and the residue played an important role in the unbinding tunnel for inhibitor leaving. Our theoretical study provided insight into the ADA inhibitor passway mechanism and may be a clue for potent ADA inhibitor design.


Concluding remarks

The major plant and animal miRNA pathways differ with respect to their biochemical mechanisms, the extent of their preferred target pairing, and numbers of functional targets. These differences have resulted in distinct characteristics of the evolution of plant and animal miRNAs. In particular, the co-evolution of target:miRNA pairs is common in plants, whereas it seems much more common for animal miRNAs to emerge and then acquire target genes. One interpretation is that this reflects independent emergence of miRNA pathways in plants and animals, on the backbone of an ancestral RNAi pathway that metabolized dsRNA into short RNAs that populate Argonaute proteins. This system might have emerged to defend against invasive nucleic acids such as viruses and transposons, and subsequently been adapted to generate miRNAs from endogenous inverted repeat transcripts. However, there are also analogies between plant and animal miRNA pathways. For example, certain vertebrate miRNA targets, as well as Drosophila hpRNA targets, exhibit 'plant-like' extensive complementarity. There is reciprocally a growing appreciation that plant miRNAs have emerged from incidentally emerged hairpins, akin to the presumed dominant mode for animal miRNA birth. Therefore, an alternative interpretation is that a miRNA pathway was extant in the last common ancestor of plants and animals, but became differentially deployed in these kingdoms.

In either case, it is clear that a limited set of core proteins, namely RNase III enzymes and Argonaute proteins, have been joined in remarkably diverse ways to control gene expression via small RNAs. Recent studies of fungal small RNA pathways provide additional evidence for innovation of RNase III-independent mechanisms for siRNA and miRNA production [136, 137], for which we can only guess at the underlying reasons that permitted the loss of canonical pathways and invention of new pathways. Altogether, it is evident that miRNAs are not a unitary entity, but instead encompass a variety of conceptually related phenomena, whose evolutionary pressures differ according to mechanism of biogenesis and even genomic location. Understanding the principles that govern the evolutionary flux of these myriad small RNA pathways will provide a fundamental complement to understanding the flux of protein-coding genes [138].


Conclusion

In this study three copies of TaOAT genes, TaAOT-5AL, TaOAT-5BL and TaAOT-5DL, were cloned and localized on the long arm of chromosome 5 in wheat. We determined that due to the phenomenon of alternative splicing, two types of transcripts exist for TaOAT-5AL. Similar to OsOAT and AtOAT, TaOATs also target to mitochondria. Phylogenetic analysis showed that this enzyme is highly conserved among monocots as well as among dicots species. In silico promoter analysis revealed quite a number of cis-acting elements in the promoter region of the TaOAT gene, suggesting its role in drought- and salinity-stresses. Furthermore, qRT-PCR analysis showed the upregulation of the TaOAT gene in response to PEG and salt stress which supports its potential role in response to both of these stresses. The transgenic wheat plants overexpressing TaOAT displayed an increased tolerances to drought and salt stress conditions. Additionally, the presence of the plant AP-2-like cis-acting element and high expression of TaOAT in stamens suggest its role in floret development. The highest expression of TaOAT at the heading stage in combination with high expression of TaOAT in stamens suggested that it plays an important role in anther dehiscence and glume opening.


MATERIALS AND METHODS

Plant Material

The T-DNA insertional mutant line mah1-1 (flanking sequence tag no. 427D09 Samson et al., 2002) was obtained from the Institut National de la Recherche Agronomique. T-DNA insertional mutant lines mah1-2 (SALK_049943) and mah1-3 (SALK_133155 Alonso et al., 2003) were obtained from the Arabidopsis Biological Resource Center. Seeds from all lines were initially planted and screened for allele homozygosity using genomic DNA extraction from leaves ( Berendzen et al., 2005) and touchdown PCR ( Don et al., 1991). Primers for screening and sequencing were designed with the aid of sequence-indexed Arabidopsis (Arabidopsis thaliana) T-DNA insertion data supplied by the Salk Institute for Genomic Analysis Web sites (http://signal.salk.edu/cgi-bin/tdnaexpress and http://signal.salk.edu/isects.html). Locations of reported insertion sites were confirmed by direct sequencing of flanking PCR products (utilizing a left-border T-DNA-specific forward primer in conjunction with a gene-specific reverse primer). Seeds from the positively identified homozygous lines were used to grow plants for all subsequent experiments.

Seeds were spread upon Arabidopsis agar plates ( Somerville and Ogren, 1982) with 5 m m KNO3, 2.5 m m KH2PO4, 2 m m MgSO4, 7H2O, 2 m m Ca(NO3)2, 4H2O, 50 μ m Fe(EDTA), 70 μ m H3BO3, 14 μ m MnCl2, 4H2O, 10 μ m NaCl, 1 μ m ZnSO4, 7H2O, 0.2 μ m NaMoO4, 2H2O, 0.05 μ m CuSO4, 0.01 μ m CoCl2, 6H2O, 0.8% agar, pH adjusted to 5.6 with KOH, and then stratified for 2 to 4 d at 4°C. Plates were placed under continuous light (approximately 150 μmol m −2 s −1 photosynthetically active radiation) for 7 to 10 d at 21°C for germination. Young seedlings were then transplanted into soil (1:1 ratio of Sunshine Mix 5 [SunGro Horticulture] and Seeding Mix [West Creek Farms]) and grown under the same light and temperature conditions as above.

Wax Extraction and Chemical Characterization

Leaves or stems were harvested from plants 4 to 7 weeks after plating. Total cuticular wax mixtures were extracted by immersing whole organs twice for 30 s into chloroform (CHCl3). The two solutions were combined, n-tetracosane (C24 alkane) was added as an internal standard, and the solvent was completely evaporated under vacuum. In TLC analyses, approximately 2 mg of wax were separated on silica gel with chloroform mobile phase using the sandwich technique ( Tantisewie et al., 1969) and visualized by staining with primuline and UV light.

For GC analyses, samples were resuspended in approximately 300 μL of CHCl3, transferred to a GC autosampler vial, dried under nitrogen, and derivatized with 10 μL of N,O-bis(trimethylsilyl) trifluoroacetamide (Sigma) and 10 μL pyridine (Fluka) for 60 min at 70°C. Wax composition was analyzed using a capillary GC (5890 n Agilent column 30-m HP-1, 0.32-mm i.d., d f = 0.1 μm Agilent) with He carrier gas inlet pressure programmed for constant flow of 1.4 mL min −1 with a MS detector (5973 n Agilent). GC was carried out with temperature-programmed on-column injection and oven temperature set at 50°C for 2 min, raised by 40°C min −1 to 200°C, held for 2 min at 200°C, raised by 3°C min −1 to 320°C, and held for 30 min at 320°C. Individual wax components were identified by comparing their mass spectra with those of authentic standards and literature data. Quantitative analysis of wax mixtures was carried out using capillary GC with flame ionization detector under the same conditions as above, but with H2 carrier gas inlet pressure regulated for constant flow of 2 mL min −1 .

Wax loads were determined by comparing GC-flame ionization detector peak areas against internal standard and dividing by the surface area extracted for the corresponding sample. Total leaf surface areas were calculated with ImageJ software ( Abramoff et al., 2004) by measuring the apparent leaf areas in digital photographs and multiplying by 2. Stem surface areas were calculated by measuring the projected two-dimensional stem areas in photographs and multiplying by π.

Semiquantitative RT-PCR

Total RNA was extracted from stems, roots, buds, and leaves of 4-week-old plants grown in soil. Tissues were ground up thoroughly in 200 μL of RNA later (Ambion/Applied Biosystems), using a tube and motorized pestle. The lysate was processed immediately by a Qiagen RNeasy plant mini kit and then used as template for RT by Moloney murine leukemia virus reverse transcriptase (New England Biolabs). cDNAs used for semiquantitative RT-PCR were normalized based on the intensity of PCR-amplified ACTIN2 fragments generated by the primers 5′-CCAGAAGGATGCATATGTTGGTGA-3′ and 5′-GAGGAGCCTCGGTAAGAAGA-3′ (yielding an approximately 250-bp fragment). MAH1 gene-specific primers 5′-AACTTTGTGCCCGCTTGGAA-3′ and 5′-ACAGCTTTGGCCACTGTCAA-3′ (generating a 434-bp fragment) were used in reactions conducted simultaneously under identical conditions as ACTIN2 controls. Because these primers amplify a downstream region of the gene stretching from +726 to +1,160 and because the mah1-1 T-DNA insert had been proposed to be localized approximately at position +692, we used an additional set of primers, 5′-ATGGCGATGCTAGGTTTTTACGTA-3′ and 5′-TTCGCCAATATCCGCAGCTT-3′ ranging from +1 to +638 to determine mah1-1 steady-state transcript levels.

Cryo-SEM

Segments from the apical 4 to 6 cm of stems were mounted onto cryo-SEM stubs using graphite paste and plunged into liquid nitrogen. Frozen stems were transferred into an Emitech K1250 cryosystem and water sublimed for 10 min at −110°C. Samples were viewed with a Hitachi S4700 field emission SEM (Nissei Sangyo America) using an accelerating voltage of 1.5 kV and a working distance of 12 mm.

Cloning of MAH1 and Construction of Vectors for Expression of MAH1:GFP and MAH1 Promoter:GUS Fusions

With aid from The Arabidopsis Information Resource SeqViewer (http://www.arabidopsis.org), 3,126 bp of Arabidopsis chromosome 1 surrounding and including the At1g57750 coding sequence (GenBank accession no. AY090941) was PCR amplified (Phusion DNA pol Finnzymes/NEB) using isolated genomic Col-0 DNA as a template with primers 5′-GCCGTTGGATGATGAATATGCACGACT-3′ and 5′-TTACAAAGATTCGAGGACCGGGCA-3′. The resulting product included the proposed 5′-UTR, 3′-UTR, the entire open reading frame (which lacks introns) of MAH1 (CYP96A15), and the additional nucleotide sequence stretching 1,310 bp upstream of the 5′-UTR. This genomic fragment was cloned into pGEM-EZ (Promega), then sequenced and found to perfectly match The Institute for Genomic Research sequence published on The Arabidopsis Information Resource. All subsequent constructs were made by using this clone as template.

Two MAH1-GFP C-terminal fusion constructs were produced using GATEWAY λ-phage-based site-specific recombination ( Landy, 1989 Hartley et al., 2000 Walhout et al., 2000). The first, pGWB4-MAH1N (the pGWB series was a kind gift from Tsuyoshi Nakagawa, Shimane University all pGWB sequences are available at http://bio2.ipc.shimane-u.ac.jp/pgwbs/index.htm), was designed to express MAH1:GFP under the control of the native (approximately 1,310 bp) promoter and the second, pGWB5-MAH135S, was designed to express MAH1:GFP under the control of the CaMV 35S promoter. pGWB4-MAH1N was constructed using the forward primer 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCTTT GCCGTTGGATGATGAATATGCACGACT-3′ (underlined sequences = directional attB sites) and the reverse primer (without a stop codon) 5′- GGGGACCACTTTGTACAAGAAAGCTGGGTT TATCTTCTTTGTGACTGTGACTTTAAGACC-3′. pGWB5-MAH135S was constructed using the forward primer 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCTTT ATGGCGATGCTAGGTTTTTACGTA-3′ along with the same reverse primer as pGWB4-MAH1N. One MAH1 promoter:GUS fusion construct (pGWB3-MAH1P) was produced by using the reverse primer 5′- GGGGACCACTTTGTACAAGAAAGCTGGGT CAAAAGGATTTATGAGTATAGATACAAAACT-3′ (spanning into the 5′-UTR) along with the forward primer from pGWB4-MAH1N.

Resultant PCR products were placed into vector pDONR221 (Invitrogen) by performing a BP reaction (attB × attP → attL + attR) using Integrase and Integration Host Factor in the form of BP Clonase II (Invitrogen). Integrated constructs were then inserted in frame into binary vectors for fusion with either GFP (pGWB4 or pGWB5) or GUS (pGWB3) by performing an attL × attR → attB + attP reaction (LR reaction with Integrase, Integration Host Factor, and excisionase in the form of LR Clonase II from Invitrogen) between the entry clone (pDONR221) and the appropriate pGWB acceptor vector. Finished binary vector constructs were sequenced to confirm that the sequence was maintained.

GUS and GFP Visualization

Expression of GUS in transgenic pGWB3-MAH1P:GUS wild-type (Col-0) plants was assayed by submerging whole-plant tissues in acetone under vacuum for 30 min and then washing in buffer composed of 0.1% Triton X-100, 0.25 m m K4Fe(CN)6, 3H2O, 0.25 m m K3Fe(CN)6, 3H2O, and 50 m m phosphate buffer, pH 7.0, three times for 5 min each. Washed tissues were subsequently stained by incubation in this same buffer with the addition of 1 m m 5-bromo-4-chloro-3-indolyl-β- d -glucuronide under vacuum for 30 min, and then at ambient pressure (with gentle agitation) at 37°C for 16 h. Afterward, stained tissues were placed in 70% ethanol and imaged using a Stemi 2000-C dissecting microscope (Zeiss) mounted with a QCAM digital camera (QImaging) and Openlab 4.01 software (Improvision).

Arabidopsis plants were immersed for 10 to 30 min either in FM4-64 (8.2 μ m ) solution ( Vida and Emr, 1995) for plasma membrane staining or in rhodamine B hexyl ester solution (1.6 μ m ) for ER staining. Autofluorescence, as well as GFP, rhodamine B hexyl ester, and FM4-64 fluorescence was examined with a Zeiss LSM 5 Pascal confocal laser-scanning microscope. The excitation wavelength for GFP was 488 nm with the emission filter set at 505 to 530 nm autofluorescence was detected using an emission filter set at 600 to 650 nm. The excitation wavelength for rhodamine B hexyl ester was 568 nm with the emission filter set at 600 to 650 nm. The excitation wavelength for FM4-64 was 514 nm with the emission filter set at 600 to 650 nm.

Statistics

Comparisons of wild-type and mutant wax data utilizing mixed-effect univariate ANOVA (α = 0.05 treatment as a fixed effect, batch nested within treatment as a random effect), Dunnett's t, and Tukey-Kramer posthoc tests (α = 0.05 using harmonic means in cases of unequal n) were conducted with SPSS 11.0 software. When necessary to meet assumptions of normality or equal variance, datasets were transformed into normal scores using Tukey's formula (r − 1/3)/(w + 1/3), where r is the rank and w is the sum of the case weights ( Tukey, 1962). For each analysis, type II error statistics (β) were also calculated. Values for β range from 0 to 1 and correspond directly to the chance of committing type II error in an ANOVA F test. The power of an ANOVA F test can be calculated as 1 − β, yielding the probability that the F test will detect the differences between groups equal to those implied by sample differences ( Sokal and Rohlf, 1995).

Supplemental Data

Supplemental Figure S1 . Cryo-SEM of inflorescence stem surfaces.

Supplemental Figure S2 . Confirmation of MAH1 subcellular localization.


Watch the video: Enzyme - Aufbau und Wirkungsweise Schlüssel-Schloss-Prinzip; Substrat- u. Wirkungsspezifität 25 (August 2022).