Information

7.3C: Citric Acid Cycle - Biology

7.3C: Citric Acid Cycle - Biology


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

The citric acid cycle is a series of reactions that produces two carbon dioxide molecules, one GTP/ATP, and reduced forms of NADH and FADH2.

Learning Objectives

  • List the steps of the Krebs (or citric acid) cycle

Key Points

  • The four-carbon molecule, oxaloacetate, that began the cycle is regenerated after the eight steps of the citric acid cycle.
  • The eight steps of the citric acid cycle are a series of redox, dehydration, hydration, and decarboxylation reactions.
  • Each turn of the cycle forms one GTP or ATP as well as three NADH molecules and one FADH2 molecule, which will be used in further steps of cellular respiration to produce ATP for the cell.

Key Terms

  • citric acid cycle: a series of chemical reactions used by all aerobic organisms to generate energy through the oxidization of acetate derived from carbohydrates, fats, and proteins into carbon dioxide
  • Krebs cycle: a series of enzymatic reactions that occurs in all aerobic organisms; it involves the oxidative metabolism of acetyl units and serves as the main source of cellular energy
  • mitochondria: in cell biology, a mitochondrion (plural mitochondria) is a membrane-enclosed organelle, often described as “cellular power plants” because they generate most of the ATP

Citric Acid Cycle (Krebs Cycle)

Like the conversion of pyruvate to acetyl CoA, the citric acid cycle takes place in the matrix of the mitochondria. Almost all of the enzymes of the citric acid cycle are soluble, with the single exception of the enzyme succinate dehydrogenase, which is embedded in the inner membrane of the mitochondrion. Unlike glycolysis, the citric acid cycle is a closed loop: the last part of the pathway regenerates the compound used in the first step. The eight steps of the cycle are a series of redox, dehydration, hydration, and decarboxylation reactions that produce two carbon dioxide molecules, one GTP/ATP, and reduced forms of NADH and FADH2. This is considered an aerobic pathway because the NADH and FADH2 produced must transfer their electrons to the next pathway in the system, which will use oxygen. If this transfer does not occur, the oxidation steps of the citric acid cycle also do not occur. Note that the citric acid cycle produces very little ATP directly and does not directly consume oxygen.

Steps in the Citric Acid Cycle

Step 1. The first step is a condensation step, combining the two-carbon acetyl group (from acetyl CoA) with a four-carbon oxaloacetate molecule to form a six-carbon molecule of citrate. CoA is bound to a sulfhydryl group (-SH) and diffuses away to eventually combine with another acetyl group. This step is irreversible because it is highly exergonic. The rate of this reaction is controlled by negative feedback and the amount of ATP available. If ATP levels increase, the rate of this reaction decreases. If ATP is in short supply, the rate increases.

Step 2. Citrate loses one water molecule and gains another as citrate is converted into its isomer, isocitrate.

Steps 3 and 4. In step three, isocitrate is oxidized, producing a five-carbon molecule, α-ketoglutarate, together with a molecule of CO2and two electrons, which reduce NAD+ to NADH. This step is also regulated by negative feedback from ATP and NADH and by a positive effect of ADP. Steps three and four are both oxidation and decarboxylation steps, which release electrons that reduce NAD+ to NADH and release carboxyl groups that form CO2 molecules. α-Ketoglutarate is the product of step three, and a succinyl group is the product of step four. CoA binds the succinyl group to form succinyl CoA. The enzyme that catalyzes step four is regulated by feedback inhibition of ATP, succinyl CoA, and NADH.

Step 5. A phosphate group is substituted for coenzyme A, and a high- energy bond is formed. This energy is used in substrate-level phosphorylation (during the conversion of the succinyl group to succinate) to form either guanine triphosphate (GTP) or ATP. There are two forms of the enzyme, called isoenzymes, for this step, depending upon the type of animal tissue in which they are found. One form is found in tissues that use large amounts of ATP, such as heart and skeletal muscle. This form produces ATP. The second form of the enzyme is found in tissues that have a high number of anabolic pathways, such as liver. This form produces GTP. GTP is energetically equivalent to ATP; however, its use is more restricted. In particular, protein synthesis primarily uses GTP.

Step 6. Step six is a dehydration process that converts succinate into fumarate. Two hydrogen atoms are transferred to FAD, producing FADH2. The energy contained in the electrons of these atoms is insufficient to reduce NAD+ but adequate to reduce FAD. Unlike NADH, this carrier remains attached to the enzyme and transfers the electrons to the electron transport chain directly. This process is made possible by the localization of the enzyme catalyzing this step inside the inner membrane of the mitochondrion.

Step 7. Water is added to fumarate during step seven, and malate is produced. The last step in the citric acid cycle regenerates oxaloacetate by oxidizing malate. Another molecule of NADH is produced.

Products of the Citric Acid Cycle

Two carbon atoms come into the citric acid cycle from each acetyl group, representing four out of the six carbons of one glucose molecule. Two carbon dioxide molecules are released on each turn of the cycle; however, these do not necessarily contain the most recently-added carbon atoms. The two acetyl carbon atoms will eventually be released on later turns of the cycle; thus, all six carbon atoms from the original glucose molecule are eventually incorporated into carbon dioxide. Each turn of the cycle forms three NADH molecules and one FADH2 molecule. These carriers will connect with the last portion of aerobic respiration to produce ATP molecules. One GTP or ATP is also made in each cycle. Several of the intermediate compounds in the citric acid cycle can be used in synthesizing non-essential amino acids; therefore, the cycle is amphibolic (both catabolic and anabolic).


7.3B: Adipose Macronutrient Metabolism

  • Contributed by Brian Lindshield
  • Associate Prof (Department of Food, Nutrition, Dietetics and Health) at Kansas State University

It probably does not surprise you that the major function of the adipose is to store energy as triglycerides. Compared to extrahepatic tissues as a whole, in the adipose the following pathways are not performed or are not important:

  • Glycogen synthesis and breakdown
  • Lactate synthesis
  • Ketone body breakdown
  • Fatty acid breakdown
  • Protein synthesis and breakdown
  • Citric acid cycle (not much since it is not an active tissue needing energy)

These pathways are crossed out in the figure below.

Figure 7.321 The metabolic pathways that are not performed or important in the adipose, compared to extrahepatic tissues as a whole are crossed out 1

Removing those pathways, we are left with metabolic capabilities listed below and depicted in the following figure:

Triglyceride synthesis and breakdown

Figure 7.322 Adipose metabolic capability

Fatty acid synthesis only occurs in the adipose and liver. In the adipose, fatty acids are synthesized and most will be esterified into triglycerides to be stored. In the liver, some fatty acids will be esterified into triglycerides to be stored, but most triglycerides will be incorporated into VLDL so that they can be used or stored by other tissues.


Citric Acid Cycle and Oxidative Phosphorylation

The citric acid cycle is a series of chemical reactions that removes high-energy electrons and uses them in the electron transport chain to generate ATP. One molecule of ATP (or an equivalent) is produced per each turn of the cycle.

The electron transport chain is the portion of aerobic respiration that uses free oxygen as the final electron acceptor for electrons removed from the intermediate compounds in glucose catabolism. The electrons are passed through a series of chemical reactions, with a small amount of free energy used at three points to transport hydrogen ions across the membrane. This contributes to the gradient used in chemiosmosis. As the electrons are passed from NADH or down the electron transport chain, they lose energy. The products of the electron transport chain are water and ATP. A number of intermediate compounds can be diverted into the anabolism of other biochemical molecules, such as nucleic acids, non-essential amino acids, sugars, and lipids. These same molecules, except nucleic acids, can serve as energy sources for the glucose pathway.


Chapter 4 Carboxylic acids as bioregulators and gut growth promoters in nonruminants

The chapter discusses carboxylic acids as bioregulators and gut growth promoters in nonruminants. The chapter presents a review of current literature relating the modes of action and effectiveness of both short and medium chain carboxylic acids relative to gut health and performance of nonruminant animals, with an emphasis on pigs. Over the past 50 years numerous studies have been addressed worldwide to evaluate four major benefits because of carboxylic acids: (1) improved health and resistance to disease, (2) faster growth, (3) increased efficiency of diet utilization, (4) better carcass quality. Secondary effects, concerning environmental pollution (less total N, volatilized ammonia, P) and/or reduced production costs have also received considerable attention. The chapter discusses the intraluminal and post-absorptive bioactivity of short-chain fatty acids (SCFA) and medium-chain fatty acids (MCFA) in nonruminants, and particularly in pigs. The chapter discusses: (1) Some essentials on the physicochemical properties of SCFA and MCFA, (2) intraluminal production rates and concentrations in particular sections of the gut, (3) direct and/or indirect effects of SCFA and MCFA on gut functionality, (4) transepithelial transport and absorptive mechanisms of SCFA, and (5) post-absorptive roles in metabolic and regulatory processes of the body.


The pressure in a cylinder containing Nitrogen continuously decreases as gas is released from it. But the pressure in a cylinder containing Propane maintains constant pressure as propane is released. Thus difference in behaviour is to be explained. Concept introduction: Gas law: Gas law states that the relationship between pressure, volume and temperature. This law is combination of Boyle’s law and Charles’s law. Boyle’s law (pressure-volume law): This law states that the volume of given quantity of gas detained at constant temperature diverges inversely with functional pressure when the temperature and mass are constant. Vα 1 P Charles’s law (temperature-volume law): This law states that volume of given quantity of gas detained at constant pressure is directly proportional to the temperature. VαT

The pressure in a cylinder containing Nitrogen continuously decreases as gas is released from it. ਋ut the pressure in a cylinder containing Propane maintains constant pressure as propane is released.  Thus difference in behaviour is to be explained.

Concept introduction:

Gas law: Gas law states that the relationship between pressure, volume and temperature. This law is combination of Boyle’s law and Charles’s law.

    Boyle’s law (pressure-volume law): This law states that the volume of given quantity of gas detained at constant temperature diverges inversely with functional pressure when the temperature and mass are constant.


1. Introduction

Germination is a complex stage of plant ontogenesis involving growth initiation but not comprising final growth processes and maturation [1,2]. The gist of germination is restoring metabolism of dormant seeds not showing any physiological activity. The process activates the seed embryo and allows for seedling growth [3,4,5]. Seven- or ten-day-old sprouts are of appropriate size for harvest, allowing for post-harvest handling and commercialization. The material shows higher content of phytochemicals than other vegetables [2].

Microgreens are immature plants produced from the seeds of vegetables, cereals or herbs. They are 5 to 10 cm long and comprise a stem and cotyledons. They are usually harvested at the base of their cotyledons, just after the cotyledons emerge but before true leaves develop. This takes place from 7 to 21 days after germination, depending on the species [6,7,8,9,10]. The life cycle of microgreens is very short, and they quickly deteriorate after harvest. When stored at room temperature, they can be safely consumed within 1 to 2 days [9]. Contrary to sprouts, the term “microgreens” is not scientific rather, it is used for marketing purposes. Their production began at the end of 1980s [6], and in recent years, they have been constantly gaining popularity due to growing interest in functional foods [10].

Germinating seeds could contain from 2 to 10 times more phytochemicals as compared with commercial adult plants. This content depends on the species cultivar environmental conditions and the time of germination, storage, and processing [10]. So far, sprouts have been more often than microgreens recognized as wellness and health-promoting foods, widely recommended by dietitians due to their high content of nutrients and bioactive compounds, such as flavonoids, hydroxycinnamic acids, vitamins and glucosinolates, minerals, and carotenoids [4,10]. These phytochemicals seem to play a crucial role in protecting the human body against different types of chronic disorders such as cardiovascular diseases, diabetes, and cancer [10,11]. Additionally, sprout and microgreen leaves are characterized by a low calorific value (29� kcal/100 g) and low glycemic index [10,11].

The number of species that can be consumed as sprouts or microgreens is huge. Their seeds differ in germination rate, taste and chemical composition. The most popular seeds used for the production of sprouts and microgreens include those of cereals, legumes, oilseeds or crucifers, e.g., lentils, soybean, broccoli, alfalfa, radish, sunflower, cress, pumpkin, mung bean or onion (chives) [1].

Nowadays, in a society that is more aware of and interested in healthy lifestyles and prevention of diseases, sprouts and microgreens seem highly desirable products. Apart from offering the mentioned health benefits, they can be easily and quickly produced and used in many different ways. Nevertheless, sprouts and microgreens are still considered innovative culinary ingredients. They are used as additions to sandwiches, salads, soups, desserts and drinks [4,10,12], and their popularity is due to their delicate texture, unique colors and high palatability, making them useful in the culinary industry. The Japanese market offers many kinds of foodstuffs based on sprouts or microgreens in the form of powder or additives to alcohols, juices, and teas [13]. They are also available all year round, even in the winter with its lack of fresh fruit and vegetables [10].

Nowadays, with aging populations increasingly often suffering from major chronic diseases of the 21st century, such as obesity, cardiovascular diseases, cancers, and type 2 diabetes, a diet rich in fruit and vegetables is often recommended as a preventive measure. All organizations with focus on nutrition (i.e., WHO, USDA from USA or IŻŻ from Poland) claim that diets rich in fruits and vegetables provide abundant compounds of known protective benefits against chronic diseases. These compounds include polyphenols, vitamins (i.e., L-ascorbic acid or carotenoids as provitamin A precursors), amino acids, or chlorophylls. It is therefore crucial to identify the health benefits of commercial sprouts and microgreens that are commonly consumed in the spring when fresh fruits, vegetables and herbs are less readily available. Studies on the relationship between chemical composition and biological activity of sprouts and microgreens are limited, yet these products are commonly offered in day to day sale.

Therefore, the aim of this work was to characterize and compare natural antioxidants (L-ascorbic acid, phenolic compounds and carotenes) and their in vitro biological activity (antioxidant capacity, anti-diabetic, anti-obesity and anti-cholinesterase activity) in sprouts and microgreens to foster their application as natural, healthy foods. An additional aim was to characterize nutritional values of sprouts and microgreens in terms of their content of amino acids, pectins, ash, sugar, organic acids and soluble solids. We also determined their dry matter and pH. Some of the selected sprouts and microgreens were investigated for the first time.


Determination of the glycogen synthesis pathway by 13 C nuclear magnetic resonance analysis ☆

The level of hepatic glycogen synthesized directly from glucose was measured in rats with [1- 13 C]glucose. The nuclear magnetic resonance (NMR) spectrum of glucose was used to measure the distribution of the 13 C label from C1 to the other carbons. Female Sprague-Dawley rats were surgically implanted with catheters in the left carotid artery and the right jugular vein, followed by a 3-day recovery period and a 24-hour fast to deplete liver glycogen. A 2-hour infusion of the fasted animal with [1- 13 C]glucose was immediately followed by the removal of blood and liver tissue. The liver was divided into the right, left, caudate, and medial lobes, and then freeze-clamped in liquid nitrogen and stored at −80°C. The 13 C NMR glucose spectra were obtained from glycogen that was isolated from each liver lobe and hydrolyzed to glucose with amyloglucosidase. Spectra were obtained at 50.3 MHz in a narrow-bore Gemini 200-MHz NMR spectrometer (Varian, Palo Alto, CA). The distribution of 13 C onto glucose carbons was measured from these spectra, and the percent direct pathway was calculated to be 29% ± 2.5%. Metabolic variation for the synthesis of glycogen within the liver was determined by measuring the direct pathway contribution in each of the four liver lobes. Percent direct pathway values were similar (P > .05) in right (35% ± 4.9%), left (26% ± 5.1%), medial (25% ± 4.9%), and caudate (27% ± 5.6%) lobes. For some of the animals, the direct pathway was determined by infusion with [6- 13 C]glucose. These results were then compared with the results of C1-labeled glucose to measure the loss of C1 from the infused glucose as CO2 in the pentose phosphate pathway (PPP). The percent direct pathway determined from [1- 13 C]glucose compared with [6- 13 C]glucose indicates negligible PPP activity from infused glucose. Finally, labeled carbon was found on C3 and C4, indicating a flow of glucose through the citric acid cycle (CAC).

Supported by National Institutes of Health Grant No. 1 R15 DK 41439-01 and a Sigma Xi Grant-In-Aid of Research.


Abstract

Amino acid-based products have been used as alternative fertilizer nitrogen (N) sources to improve turfgrass performance, especially where there is a strong reliance on synthetic N sources. However, the physiological mechanisms underlying improvements in turfgrass performance are not well documented. The objective of this research was to determine whether applications of a tryptophan-containing organic byproduct (TRP-B) or tryptophan (TRP) + urea improve creeping bentgrass (Agrostis stolonifera L.) performance compared with standalone applications of urea, a commonly used synthetic N source. At two separate universities, mature ‘A-4’ creeping bentgrass plugs were transplanted into containers and allowed to re-establish in growth chambers before being treated. Treatments included TRP-B, urea, and TRP + urea applied every 14 d at three different N rates: 2.5, 12.25, and 24.5 kg N ha −1 . At the trial's end, TRP-B and TRP + urea increased leaf indole-3-acetic acid (IAA) by 227 and 255%, respectively, relative to urea at the high N rate, as measured at day 42 of the study. Applications of TRP-B and TRP + urea also increased root biomass by 22 and 20%, respectively, when compared with urea only at the high N rate. The TRP-B and TRP + urea treatments did not impact leaf total amino acids or photochemical efficiency when compared with urea only. Overall, results indicate that application of TRP-B or TRP + urea at 24.5 kg N ha −1 every 2 wk may improve leaf and root IAA content, root biomass, and subsequent creeping bentgrass quality relative to applications of urea only.

Abbreviations

C reeping bentgrass (Agrostis stolonifera L.) is a cool-season grass species that is commonly used for intensely managed, high-value sports surfaces. Like all cool-season grasses, as the growing season progresses, creeping bentgrass can experience periods of decline (Dernoeden, 2000 ). Symptoms of bentgrass decline during the growing season include root dieback, excessive leaf senescence, and thinning of the turf canopy.

Amino acid-containing products have been used to improve cool-season turfgrass root growth and improve turfgrass quality (Zhang et al., 2013 ). In recent years, various biostimulants and biofertilizer products have been developed for the specialty turfgrass market (Schmidt et al., 2003 Ervin and Zhang, 2008 ), some of which contain amino acids as base ingredients (Ervin et al., 2004 , 2009 ). Amino acids are building blocks of proteins, enzymes, nucleic acids, antioxidants, and other secondary compounds (Taiz and Zeiger, 2010 ) and are readily absorbed and translocated by plant tissues (Joy and Antcliff, 1966 Mäkelä et al., 1996 ). Exogenous application of an amino acid-based product prior to and during periods of decline could serve to boost endogenous amino acids and the subsequent production of important stress-protective compounds such as proline and antioxidants (Carbonera et al., 1989 Vidmar et al., 2000 Bhowmik et al., 2008 ).

Tryptophan (TRP), an amino acid, is a primary precursor in the biosynthesis of the phyto-hormone indole-3-acetic acid (IAA), or auxin. Auxin functions as a growth regulator to increase root initiation and delay leaf senescence (Zhang et al., 2013 ). Zhang et al. ( 2009 ) showed that application of a TRP-dosed organic fertilizer enhanced endogenous levels of IAA and cytokinins, increased leaf antioxidant enzyme activity, and improved root growth in tall fescue [Schenodorus arundinceus (Schreb.) Dumort.]. Tryptophan can act as an osmolyte, an ion-transport regulator, and a stomatal opening modulator (Rai, 2002 ). Application of TRP may improve nitrogen (N) metabolism and chlorophyll content, as demonstrated by Rao et al. ( 2012 ), where applications of L -tryptophan to maize (Zea mays L.) increased leaf relative water content and chlorophyll content and reduced cell membrane damage.

A common problem that turfgrass managers face is that of maintaining growth in a sand-based rootzone. Sand-based rootzones present a unique dilemma, where the cation exchange capacity (CEC) or nutrient holding capacity is extremely low, and water drainage and infiltration rates are relatively high. Under these conditions, nutrients applied to the soil have a high leaching probability. Because of this, turfgrass managers often utilize what is known as spoon feeding, where a small amount of fertilizer is applied more frequently instead of applying the required amount all at one time. The idea behind this method is that the turf is receiving an adequate amount of fertilizer that will improve growth, but that amount is not enough to result in significant nutrient loss or pollution (Howieson and Christians, 2001 ). Urea is a synthetic N source that is commonly used in a spoon-feeding nutrient program due to its high water solubility and low price (Howieson and Christians, 2001 ).

The objectives of this study were (i) to determine whether applications of a TRP-containing byproduct (TRP-B) or TRP + urea improve creeping bentgrass performance when compared with urea alone at equivalent N levels, and (ii) to identify a proper rate of TRP-B that would match a spoon-feeding rate of urea that a golf course superintendent would use on a creeping bentgrass putting green, tee, or fairway.


Solid-phase route to Fmoc-protected cationic amino acid building blocks

Diamino acids are commonly found in bioactive compounds, yet only few are commercially available as building blocks for solid-phase peptide synthesis. In the present work a convenient, inexpensive route to multiple-charged amino acid building blocks with varying degree of hydrophobicity was developed. A versatile solid-phase protocol leading to selectively protected amino alcohol intermediates was followed by oxidation to yield the desired di- or polycationic amino acid building blocks in gram-scale amounts. The synthetic sequence comprises loading of (S)-1-(p-nosyl)aziridine-2-methanol onto a freshly prepared trityl bromide resin, followed by ring opening with an appropriate primary amine, on-resin N β -Boc protection of the resulting secondary amine, exchange of the N α -protecting group, cleavage from the resin, and finally oxidation in solution to yield the target γ-aza substituted building blocks having an Fmoc/Boc protection scheme. This strategy facilitates incorporation of multiple positive charges into the building blocks provided that the corresponding partially protected di- or polyamines are available. An array of compounds covering a wide variety of γ-aza substituted analogs of simple neutral amino acids as well as analogs displaying high bulkiness or polycationic side chains was prepared. Two building blocks were incorporated into peptide sequences using microwave-assisted solid-phase peptide synthesis confirming their general utility.

This is a preview of subscription content, access via your institution.


4. Materials and Methods

4.1 General Procedures

All chemicals (reagent grade) used were purchased from Sigma𠄺ldrich (USA) and Sinopharm Chemical Reagent Co. Ltd. (China). 1 H NMR spectra were measured on Varian Unity Inova 300 or 400 MHz NMR Spectrometers at 25 ଌ and referenced to TMS. Chemical shifts are reported in ppm using the residual solvent line as internal standard. Splitting patterns are designed as s, singlet d, doublet t, triplet m, multiplet. HRMS spectra were acquired on an Agilent Technologies 6220 Accurate-Mass TOF LC/MS. Analytical thin-layer chromatography (TLC) was performed on the glass-backed silica gel sheets (silica gel 60 Å GF254). All compounds were detected using UV light (254 or 365 nm). Analytical HPLC was conducted on SHIMADZU LC-20AD. Prior to Ki measurement, all compounds were determined to be 㺕% pure by HPLC based on the peak area percentage.

4.1.1. (R)-2-Hydroxy-3,3-dimethylbutanoic acid (7)

To a solution of 6 (1.0 g, 7.62 mmol, 1.0 equiv) in 0.5 M H2SO4 at 0 ଌ was added a solution of NaNO2 (3.15 g, 45.6 mmol, 6.0 equiv) in H2O (10 mL) dropwise over 30 min. After addition was complete the solution was warmed to 23 ଌ and stirred overnight (

16 h). The reaction mixture was diluted with H2O (30 mL), extracted with diethyl ether (3 × 30 mL) and the combined organic layers were dried (Na2SO4), and concentrated to afford 7 (806 mg, 81%) as a colorless oil, which was used directly in next reaction. 1 H NMR (400 MHz, CDCl3) δ 3.90 (s, 1H), 1.02 (s, 9H) MS (ESI–) calcd for C6H11O3 [M–H] – 131.1, found 131.4.

4.1.2. (R)-2-(tert-Butyldimethylsilyl)oxy-3,3-dimethylbutanoic acid (8)

To a solution of 7 (2.06 g, 15.6 mmol, 1.0 equiv) in DMF (15 mL) were added imidazole (5.09 g, 74.8 mmol, 4.8 equiv) and tert-butylchlorodimethylsilane (5.64 g, 37.4 mmol, 2.4 equiv). The mixture was stirred overnight at 23 ଌ then extracted with 1:1 ethyl acetate–petroleum ether (3 × 30 mL). The organic layer was washed successively with a 10% aqueous citric acid solution, H2O, saturated aqueous NaHCO3, and brine, then dried (Na2SO4), and concentrated. The residue was dissolved in methanol (100 mL), then an aqeuous 0.8 M K2CO3 solution (50 mL) was added. After 4 h, 10% citric acid aqueous solution was added to adjust pH to 4. The mixture was extracted with ethyl acetate (3 × 30 mL) and the combined organic layers were dried (Na2SO4) and concentrated. The residue was purified by flash chromatography (10:1 petroleum ether𠄾thyl acetate) to afford the title compound (3.1 g, 81%) as a colorless oil: 1 H NMR (400 MHz, CDCl3) δ 9.64 (br s, 1H), 3.83 (s, 1H), 0.97 (s, 9H), 0.93 (s, 9H), 0.08 (s, 3H), 0.06 (s, 3H) 13 C NMR (100 MHz, CDCl3) δ 176.6, 80.0, 35.4, 26.0, 25.8, 18.3, 𢄥.2 (2 C) MS (ESI–) calcd for C12H25O3Si [M–H] – 245.2, found 245.2.

4.1.3. (R)-2,5-Dioxopyrrolidin-1-yl-2-(tert-butyldimethylsilyl)oxy-3,3-dimethylbutanoate (9)

To a solution of 8 (1.99 g, 8.1 mmol, 1.0 equiv) in DME (50 mL) at 0 ଌ, N-hydroxysuccinimide (1.87 g, 16.2 mmol, 2.0 equiv) and DCC (2.34 g, 11.3 mmol, 1.4 equiv) were added and the mixture was stirred overnight at 23 ଌ. The mixture was filtered through a short pad of Celite washing with ethyl acetate and the filtrate was concentrated. The residue was purified by flash chromatography (1:1 petroleum ether𠄼H2Cl2) to afford the title compound (1.60 g, 60%) as a colorless oil: 1 H NMR (400 MHz, CDCl3) δ 4.09 (s, 1H), 2.81 (br s, 4H), 1.05 (s, 9H), 0.92 (s, 9H), 0.12 (s, 3H), 0.09 (s, 3H) 13 C NMR (100 MHz, CDCl3) δ 169.1, 168.1, 78.5, 36.0, 25.7 (3C), 18.2, 𢄥.2, 𢄥.5 MS (ESI–) calcd for C16H29NO5Si [M] – 343.2, found 342.8.

4.1.4. 5′-O-[N-((R)-2-Hydroxy-3,3-dimethylbutanoyl)sulfamoyl]adenosine (1a)

To a solution of 10 25 (100 mg, 0.26 mmol, 1.0 equiv) in DMF (1.0 mL) was added 9 (179 mg, 0.52 mmol, 2.0 equiv) and Cs2CO3 (169 mg, 0.52 mmol, 2.0 equiv) at 23 ଌ. After stirring 24 h at 23 ଌ, the solution was concentrated in vacuo. Purification by flash chromatography (500:6:1.5 CH2Cl2–MeOH𠄾t3N) afforded 5′-O-<N-[(R)-2-(tert-butyldimethylsilyl)oxy-3,3-dimethylbutanoyl]sulfamoyl>-2′,3′-O-isopropylideneadenosine triethylammonium salt (72 mg) as a yellow solid. This compound was dissolved in 80% aqueous TFA (2 mL). After stirring 48 h at 8 ଌ, the solution was concentrated in vacuo. Purification by flash chromatography (10:1 CH2Cl2–MeOH) afforded the title compound (8 mg, 7% yield from compound 10) as a white solid: 1 H NMR (400 MHz, CD3OD) δ 8.57 (s, 1H), 8.33 (s, 1H), 6.38 (s, 1H), 5.05𠄵.00 (m, 1H), 4.79𠄴.77 (m, 1H), 4.74𠄴.70 (m, 1H), 4.40𠄴.37 (m, 1H), 4.14𠄴.10 (m, 1H), 3.62 (s, 1H), 0.99 (s, 9H) 13 C NMR (100 MHz, CD3OD) δ 179.0, 158.7, 150.3, 140.9, 140.6, 121.2, 95.3, 85.2, 80.3, 77.2, 71.7, 59.7, 36.1, 26.5 HRMS (ESI–) calcd for C16H23N6O8S [M–H] – 459.1304, found 459.1310.

4.1.5. 2′,3′,5′-O-tri(tert-Butyldimethylsilyl)vidarabine (12)

To a solution of vidarabine 11 (200 mg, 0.748 mmol, 1 equiv) in DMF (1.5 mL) were added imidazole (306 mg, 4.49 mmol, 6.0 equiv) and TBSCl (677 mg, 4.49 mmol, 6.0 equiv) and the reaction was stirred overnight at 23 ଌ The reaction mixture was partitioned between EtOAc and H2O and the organic layer was dried (NaSO4), and concentrated. Purification by flash chromatography (80:1 CH2Cl2–MeOH) afforded the title compound (319 mg, 70%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 8.36 (s, 1H), 8.03 (s, 1H), 6.48 (d, J = 3.6 Hz, 1H), 5.59 (s, 2H), 4.34𠄴.32 (m, 1H), 4.19𠄴.16 (m, 1H), 4.03𠄳.98 (m, 1H), 3.88𠄳.84 (m, 2H), 0.94 (s, 9H), 0.92 (s, 9H), 0.72 (s, 9H), 0.15 (s, 6H), 0.09 (s, 3H), 0.08 (s, 3H), 𢄠.08 (s, 3H), 𢄠.45 (s, 3H) 13 C NMR (75 MHz, CDCl3) δ 155.5, 153.0, 149.6, 140.8, 119.3, 86.5, 85.9, 78.3, 77.6, 63.0, 26.1, 25.9, 25.7, 18.5, 18.1, 17.9, 𢄤.4, 𢄥.2, 𢄥.5 MS (ESI+) calcd for C28H56N5O4Si3[M+H] + 610.4, found 610.0.

4.1.6. 2′,3′-O-di(tert-Butyldimethylsilyl)vidarabine (13)

To a solution of 12 (50 mg, 0.082 mmol) in THF (0.5 mL) was added 35% aqueous TFA (2 mL). The reaction mixture was stirred for 2 h at 23 ଌ., then quenched with saturated aqueous NaHCO3 and extracted with EtOAc. The combined organic layers were dried (NaSO4) and concentrated. Purification by flash chromatography (80:1 CH2Cl2–MeOH) afforded the title compound (33 mg, 81%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 8.30 (s, 1H), 8.05 (s, 1H), 6.44 (d, J = 4.0 Hz, 1H), 5.83 (s, 2H), 4.38𠄴.34 (m, 1H), 4.31𠄴.27 (m, 1H), 4.13 (s, 1H), 4.08𠄴.04 (m, 1H), 3.92𠄳.88 (m, 2H), 0.94 (s, 9H), 0.67 (s, 9H), 0.16 (s, 6H), 𢄠.06 (s, 3H), 𢄠.41 (s, 3H) 13 C NMR (75 MHz, CD3OD) δ 156.8, 153.6, 149.7, 141.9, 119.5, 88.0, 87.1, 79.1, 78.4, 62.6, 26.2, 26.0, 18.6, 18.3, 𢄤.2, 𢄤.4, 𢄤.8, 𢄥.4 MS (ESI+) calcd for C22H42N5O4Si2 [M+H] + 496.3, found 496.0.

4.1.7. 2′,3′-O-di(tert-Butyldimethylsilyl)-5′-O-(sulfamoyl)vidarabine (14)

To a solution of 13 (100 mg, 0.2 mmol, 1.0 equiv) in 1,4-dioxane (5 mL) was added NaH (60% w/w in mineral oil, 60 mg, 1.5 mmol, 7.5 equiv). The reaction mixture was stirred for 1 h at 23 ଌ. Next, NH2SO2Cl 27 (58 mg, 0.5 mmol, 2.5 equiv) was added and the reaction was stirred for 24 h, then quenched by the slow addition of 5:1 CH2Cl2–MeOH (10 mL). The reaction mixture was filtered through silica gel and the filtrate was concentrated. Purification by flash chromatography (30:1 CH2Cl2–MeOH) afforded the title compound (70 mg, 60%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 8.22 (s, 2H), 6.48 (d, J = 3.2 Hz, 1H), 4.48 (dd, J = 10.4, 7.2 Hz, 1H), 4.40𠄴.24 (m, 4H), 0.98 (s, 9H), 0.72 (s, 9H), 0.22 (s, 6H), 𢄠.02 (s, 3H), 𢄠.43 (s, 3H) 13 C NMR (75 MHz, DMSO-d6) δ 155.9, 152.7, 149.1, 139.8, 118.3, 84.2, 81.9, 77.3, 76.5, 68.1, 25.7, 25.4, 17.6, 17.3, 𢄤.6, 𢄤.7, 𢄥.4, 𢄥.8 MS (ESI+) calcd for C22H43N6O6SSi2 [M+H] + 575.2, found 574.8.

4.1.8. 5′-O-[N-((R)-2-Hydroxy-3,3-dimethylbutanoyl)sulfamoyl]vidarabine (2)

To a solution of 14 (420 mg, 0.70 mmol, 1.0 equiv) in DMF (10 mL) was added 9 (497 mg, 1.40 mmol, 2.0 equiv) and Cs2CO3 (476 mg, 1.40 mmol, 2.0 equiv). The reaction was stirred for 24 h then concentrated in vacuo. The residue was purified by flash chromatography (500:6:1.5 CH2Cl2–MeOH𠄾t3N) to afford 2′,3′-O-di(tert-butyldimethylsilyl)-5′-O-<N-[(R)-2-(tert-butyldimethylsilyloxy)-3,3-dimethylbutanoyl]sul- famoyl>vidarabine triethylammonium salt (80 mg) as a yellow solid. This intermediate was dissolved in 80% aqueous TFA (2 mL). After stirring 60 h at 23 ଌ, the solution was concentrated in vacuo. Purification by flash chromatography (10:1 CH2Cl2–MeOH) afforded the title compound (10 mg, 3% yield from compound 14) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 8.58 (s, 1H), 8.19 (s, 1H), 6.38 (d, J = 5.2 Hz, 1H), 5.01 (d, J = 13.6 Hz, 1H), 4.74 (d, J = 2.4 Hz, 1H), 4.68 (dd, J = 16.0, 2.4 Hz, 1H), 4.52 (t, J = 5.2 Hz, 1H), 3.95 (t, J = 5.2 Hz, 1H), 3.64 (s, 1H), 1.00 (s, 9H) 13 C NMR (100 MHz, CD3OD) δ 179.6, 158.7, 150.1, 142.2, 141.5, 121.3, 91.8, 85.7, 81.3, 80.2, 76.9, 59.8, 36.2, 26.5 HRMS (ESI–) calcd for C16H23N6O8S [M–H] – 459.1304, found 459.1318.

4.1.9. 3′,5′-O-di(tert-Butyldimethylsilyl)vidarabine (15)

To a solution of vidarabine 11 (2.0 g, 7.5 mmol, 1.0 equiv) in DMF (40 mL) were added triethylamine (5.2 mL, 37 mmol, 5.0 equiv) and TBSCl (2.82 g, 18.7 mmol, 2.5 equiv). The reaction mixture was stirred for 16 h at 23 ଌ then partitioned between EtOAc and H2O. The organic layer was dried (NaSO4), and concentrated. Purification by flash chromatography (80:1 CH2Cl2–MeOH) afforded the title compound (2.4 g, 65%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 8.35 (s, 1H), 8.27 (s, 1H), 6.33 (d, J = 2.4 Hz, 1H), 5.65 (s, 2H), 4.88 (d, J = 10.0 Hz, 1H), 4.37𠄴.34 (m, 1H), 4.14 (d, J = 10.0 Hz, 1H), 4.07 (s, 1H), 3.96 (d, J = 11.2 Hz, 1H), 3.81 (d, J = 11.2 Hz, 1H), 0.93 (s, 9H), 0.93 (s, 9H), 0.15 (s, 6H), 0.14 (s, 6H) MS (ESI+) calcd for C22H42N5O4Si2 [M+H] + 496.3, found 496.4.

4.1.10. 3′,5′-O-di(tert-Butyldimethylsilyl)-2′-deoxy-2′-fluoroadenosine (16)

To a solution of 15 (100 mg, 0.20 mmol, 1.0 equiv) and pyridine (0.20 mL, 10 mmol, 10 equiv) in CH2Cl2 (3 mL) at 23 ଌ was added diethylaminosulfur trifluoride (DAST) (50.1 μL, 1.0 mmol, 5.0 equiv). The reaction mixture was stirred for 6 h at 23 ଌ then quenched with 5% aqueous NaHCO3 (15 mL) and extracted with CH2Cl2 (3 × 30 mL). The combined organic layers were dried (NaSO4) and concentrated. Purification by flash chromatography (50:1 CH2Cl2–MeOH) afforded the title compound (20 mg, 31%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 8.32 (s, 1H), 8.16 (s, 1H), 6.25 (dd, J = 15.6, 1.6 Hz, 1H), 6.05 (s, 2H), 5.32 (dd, J = 52.8, 1.6 Hz, 1H), 4.73𠄴.64 (m, 1H), 4.16𠄴.12 (m, 1H), 4.02 (dd, J = 12.0, 2.4 Hz, 1H), 3.79 (dd, J = 12.0, 2.4 Hz, 1H), 0.93 (s, 9H), 0.89 (s, 9H), 0.14 (s, 3H), 0.13 (s, 3H), 0.08 (s, 3H), 0.06 (s, 3H) 13 C NMR (75 MHz, CDCl3) δ 155.8, 153.3, 149.4, 139.3, 120.1, 93.0 (d, J = 191.3 Hz), 87.0 (d, J = 33.0 Hz), 84.0, 69.4 (d, J = 15.8 Hz), 61.3, 26.0, 25.8, 18.5, 18.2, 𢄤.6, 𢄤.9, 𢄥.3, 𢄥.4 MS (ESI+) calcd for C22H41FN5O3Si2 [M+H] + 498.3, found 498.3.

4.1.11. 3′-O-(tert-Butyldimethylsilyl)-2′-deoxy-2′-fluoroadenosine (17)

To a solution of 16 (100 mg, 0.20 mmol) in THF (0.5 mL) was added 35% aqueous 7 TFA (2 mL) at 23 ଌ. The solution was stirred for 20 min, then quenched with saturated aqueous NaHCO3 solution. The mixture was extracted with EtOAc (3 × 10 mL) and the combined extracts were dried (NaSO4), and concentrated. Purification by flash chromatography (50:1 CH2Cl2–MeOH) afforded the title compound (71 mg, 92%) as a white solid: 1 H NMR (400 MHz, CD3OD) δ 8.37 (s, 1H), 8.19 (s, 1H), 6.27 (dd, J = 15.2, 4.0 Hz, 1H), 5.51 (dt, J = 52.8, 4.0 Hz, 1H), 4.79𠄴.72 (m, 1H), 4.15 (d, J = 2.0 Hz, 1H), 3.90 (d, J = 12.4 Hz, 1H), 3.71 (dd, J = 12.8, 2.4 Hz, 1H), 0.96 (s, 9H), 0.18 (s, 3H), 0.17 (s, 3H) 13 C NMR (75 MHz, DMSO-d6) δ 156.2, 152.6, 148.8, 139.6, 119.2, 92.3 (d, J = 189.0 Hz), 85.7 (d, J = 32.3 Hz), 84.7, 70.0 (d, J = 15.0 Hz), 60.3, 25.6, 17.9, 𢄤.9, 𢄥.1 MS (ESI+) calcd for C16H27FN5O3Si [M+H] + 384.2, found 384.2.

4.1.12. 3′-O-(tert-Butyldimethylsilyl)-2′-deoxy-2′-fluoro-5′-O-(sulfamoyl)adenosine (18)

To a solution of 17 (100 mg, 0.26 mmol, 1.0 equiv) in 1,4-dioxane (5 mL) was added NaH (60 dispersion w/w in mineral oil, 32 mg, 0.78 mmol, 3.0 equiv) at 23 ଌ. After 1h, NH2SO2Cl 27 (75 mg, 0.65 mmol, 2.5 equiv) was added and the solution was stirred for 16 h at 23 ଌ. The reaction was quenched by the slow addition of 5:1 CH2Cl2–MeOH (10 mL) then the mixture was filtered through silica gel and the filtrate was concentrated. Purification by flash chromatography (30:1 CH2Cl2–MeOH) afforded the title compound (72 mg, 60%) as a white solid: 1 H NMR (300 MHz, CD3OD) δ 8.26 (s, 1H), 8.21 (s, 1H), 6.31 (dd, J = 17.1, 2.7 Hz, 1H), 5.53 (ddd, J = 52.5, 4.5, 2.7 Hz, 1H), 4.94𠄴.91 (m, 1H), 4.46𠄴.40 (m, 1H), 4.32𠄴.26 (m, 2H), 0.97 (s, 9H), 0.21 (s, 3H), 0.19 (s, 3H) 13 C NMR (75 MHz, DMSO-d6) δ 156.2, 152.8, 148.8, 139.7, 119.1, 92.2 (d, J = 187.5 Hz), 86.1 (d, J = 33.8 Hz), 80.3, 70.2 (d, J = 15.0 Hz), 67.7, 25.6, 17.8, 𢄤.9, 𢄥.1 MS (ESI+) calcd for C16H28FN6O5SSi [M+H] + 463.2, found 463.2.

4.1.13. 2′-Deoxy-2′-fluoro-5′-O-[N-((R)-2-Hydroxy-3,3-dimethylbutanoyl)sulfamoyl] adenosine (3)

To a solution of 18 (140 mg, 0.30 mmol, 1.0 equiv) in DMF (8 mL) was added 9 (196 mg, 0.60 mmol, 2.0 equiv) and Cs2CO3 (206 mg, 0.60 mmol, 2.0 equiv) at 23 ଌ. The reaction mixture was stirred for 20 h at 23 ଌ, then concentrated in vacuo. The residue was purified by flash chromatography (500:6:1.5 CH2Cl2–MeOH𠄾t3N) to afford 3′-O(tert-butyldimethylsilyl)-5′-O-<N-[(R)-2-(tert-butyldimethylsilyloxy)-3,3-dimethylbutanoyl] sulfamoyl>-2′-deoxy-2′-fluoroadenosine triethylammonium salt (80 mg) as a yellow solid. The compound was dissolved in 80% aqueous TFA (1 mL) and the solution was stirred at 20 ଌ for 72 h. The solvent was removed in vacuo. Purification by flash chromatography (10:1 CH2Cl2–MeOH) afforded the title compound (5.0 mg, 4% yield from 18) as a white solid: 1 H NMR (400 MHz, CD3OD) δ 8.56 (s, 1H), 8.30 (s, 1H), 6.68 (d, J = 6.8 Hz, 1H), 4.97 (dd, J = 51.6, 4.4 Hz, 1H), 4.86𠄴.82 (m, 2H), 4.76 (dd, J = 14.0, 2.8 Hz, 1H), 4.50 (dt, J = 18.8, 4.4 Hz, 1H), 3.63 (s, 1H), 0.98 (s, 9H) 13 C NMR (100 MHz, CD3OD) δ 179.1, 158.7, 150.4, 141.0, 140.5, 121.3, 94.3 (d, J = 192.0 Hz), 92.4 (d, J = 31.0 Hz), 84.8, 80.2 (d, J = 7.0 Hz), 71.5 (d, J = 16.0 Hz), 59.5, 36.2, 26.5 HRMS (ESI–) calcd for C16H22FN6O7S [M–H] – 461.1260, found 461.1280.

4.1.14. 5′-O-[N-((R)-2-Hydroxy-3,3-dimethylbutanoyl)sulfamoyl]aristeromycin (4)

To a solution of 19 31 (89 mg, 0.19 mmol, 1.0 equiv) in DMF (5 mL) was added 9 (128 mg, 0.38 mmol, 2.0 equiv) and Cs2CO3 (122 mg, 0.38 mmol, 2.0 equiv). The reaction mixture was stirred for 20 h at 23 ଌ then concentrated in vacuo. The residue was purified by flash chromatography (500:8:1.5 CH2Cl2–MeOH𠄾t3N) to afford 5′-O-<N-[(R)-2-(tert-butyldimethylsilyl)oxy-3,3-dimethylbutanoyl]sulfamoyl>-2′,3′-O-isopropylidenearisteromycin triethylammonium salt (50 mg) as a yellow solid. The compound was dissolved in 80% aqueous TFA (1.0 mL) and the solution was stirred at 8 ଌ for 48 h. The solvent was removed in vacuo. Purification by flash chromatography (10:1 CH2Cl2–MeOH) afforded the title compound (6 mg, 7% yield from compound 19) as a white solid: 1 H NMR (400 MHz, CD3OD) δ 8.56 (s, 1H), 8.27 (s, 1H), 5.04 (d, J = 4.8 Hz, 1H), 4.93 (dd, J = 13.6, 3.6 Hz, 1H), 4.55 (dd, J = 13.6, 2.8 Hz, 1H), 4.11𠄴.07 (m, 1H), 4.02 (d, J = 4.8 Hz, 1H), 3.69 (s, 1H), 3.05𠄲.96 (m, 1H), 2.80 (d, J = 10.0 Hz, 1H), 2.04 (d, J = 14.4 Hz, 1H), 1.00 (s, 9H) 13 C NMR (100 MHz, CD3OD) δ 179.1, 158.6, 150.5, 143.5, 141.2, 121.7, 80.3, 77.5, 74.4, 67.4, 60.6, 44.0, 36.1, 33.5, 26.5 HRMS (ESI–) calcd for C17H25N6O7S [M–H] – 457.1511, found 457.1510.

4.1.15. (4R)-5,5-Dimethyl-4-hydroxymethyl-2-phenyl-1,3-dioxane (22)

To a mixture of 21 32 (371 mg, 2.77 mmol, 1.0 equiv) and benzaldehyde dimethyl acetal (548 mg, 3.04 mmol, 1.1 equiv) in CH2Cl2 (300 mL) was added camphorsulfonic acid (50 mg, 0.28 mmol, 0.1 equiv) at 23 ଌ. The reaction mixture was refluxed for 24 h, then saturated NaHCO3 aqueous solution was added to adjust the pH to 7. The mixture was extracted with EtOAc, and the combined organic extracts were washed with saturated aqueous NaCl, dried (NaSO4), and concentrated. Purification by flash chromatography (6:1 petroleum ether𠄾tOAc) afforded the title compound (500 mg, 85%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 7.52 (d, J = 6.8 Hz, 2H), 7.43𠄷.33 (m, 3H), 5.51 (s, 1H), 3.69𠄳.60 (m, 5H), 1.14 (s, 3H), 0.84 (s, 3H) 13 C NMR (100 MHz, CDCl3) δ 138.4, 129.2, 128.4, 126.4, 102.2, 86.0, 79.0, 61.6, 31.7, 21.5, 19.3 MS (ESI+) calcd for C13H19O3 [M+H] + 223.1, found 223.0.

4.1.16. (4R)-5,5-Dimethyl-2-phenyl-4-[(trifluoromethanesulfonyl)oxy]methyl-1,3-dioxane (23)

To a solution of 22 (135 mg, 0.61 mmol, 1.0 equiv) and Et3N (0.2 mL) in CH2Cl2 (5 mL) was added TsCl (173 mg, 0.91 mmol, 1.5 equiv) at 0 ଌ. The mixture was then warmed to 23 ଌ and stirred for 16 h. The solvent was removed in vacuo and the residue was purified by flash chromatography (10:1 petroleum ether𠄾tOAc) to afford the title compound (190 mg, 83%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 7.80 (d, J = 8.0 Hz, 2H), 7.48𠄷.34 (m, 5H), 7.27 (d, J = 8.0 Hz, 2H), 5.43 (s, 1H), 4.28 (dd, J = 10.8, 2.0 Hz, 1H), 4.11𠄴.03 (m, 1H), 3.91𠄳.85 (m, 1H), 3.65 (dd, J = 30.0, 11.2 Hz, 2H), 2.43 (s, 3H), 1.10 (s, 3H), 0.87 (s, 3H) 13 C NMR (100 MHz, CDCl3) δ 144.8, 138.0, 132.9, 129.8, 129.0, 128.2, 128.0, 126.2, 101.6, 82.5, 78.5, 69.5, 31.8, 21.7, 21.4, 18.8 MS (ESI+) calcd for C20H24O5SNa [M+Na] + 399.1, found 399.0.

4.1.17. (4R)-4-Azidomethyl-5,5-dimethyl-2-phenyl-1,3-dioxane (24)

To a solution of 23 (185 mg, 0.49 mmol, 1.0 equiv) in DMF (3 mL) was added NaN3 (96 mg, 1.47 mmol, 3.0 equiv) and the mixture was refluxed at 100 ଌ for 16 h. The mixture was extracted with diethyl ether and the combined organic layers were dried (NaSO4), and concentrated. Purification by flash chromatography (10:1 petroleum ether𠄾tOAc) afforded the title compound (113 mg, 93%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 7.55 (d, J = 6.8 Hz, 2H), 7.43𠄷.32 (m, 3H), 5.58 (s, 1H), 3.81 (d, J = 9.2 Hz, 1H), 3.74 (d, J = 11.2 Hz, 1H), 3.65 (d, J = 11.2 Hz, 1H), 3.46 (dd, J = 12.8, 9.2 Hz, 1H), 3.20 (d, J = 13.2 Hz, 1H), 1.16 (s, 3H), 0.84 (s, 3H) 13 C NMR (100 MHz, CDCl3) δ 138.1, 128.9, 128.3, 126.1, 101.7, 84.7, 78.8, 50.7, 32.3, 21.5, 18.9 MS (ESI+) calcd for C13H17N3O2Na [M+Na] + 270.1, found 270.0.

4.1.18. (4R)-4-Aminomethyl-5,5-dimethyl-2-phenyl-1,3-dioxane (25)

To a solution of 24 (100 mg, 0.4 mmol, 1.0 equiv) in MeOH (3 mL) under nitrogen was added 10% w/w Pd/C (20 mg). The nitrogen atmosphere was replaced with an atmosphere of H2 and the mixture was stirred at 23 ଌ for 2 h. The reaction mixture was then filtered through Celite washing with MeOH and the filtrate was concentrated to afford the title compound (67 mg, 75%) as a white solid: 1 H NMR (400 MHz, CDCl3) 1 H NMR (300 MHz, CDCl3) δ 7.56𠄷.28 (m, 5H), 5.47 (s, 1H), 3.89 (br s, 2H), 3.60𠄳.52 (m, 3H), 2.88𠄲.67 (m, 2H), 1.08 (s, 3H), 0.78 (s, 3H) 13 C NMR (75 MHz, CDCl3) δ 138.6, 128.8, 128.2, 126.1, 101.9, 87.5, 78.8, 41.4, 32.0, 21.4, 19.0 MS (ESI+) calcd for C13H20NO2 [M+H] + 222.1, found 222.2.

4.1.19. 4-Nitrophenyl-[((4R)-5,5-dimethyl-2-phenyl-1,3-dioxan-4-yl)methyl]sulfamate (26)

To a solution of 25 (60 mg, 0.27 mmol, 1.0 equiv) and 4-nitrophenol (375 mg, 2.7 mmol, 10.0 equiv) in CH2Cl2 (3 mL) was added 4-nitrophenyl chlorosulfate (192 mg, 0.81 mmol, 3.0 equiv) dropwise in CH2Cl2 (3 mL) at � ଌ. The reaction was stirred 2 h at � ଌ, then diluted with CH2Cl2 and warmed to 23 ଌ followed by consecutive washes with 1 M NaH2PO4 and H2O. The organic layer was dried (Na2SO4) and concentrated. Purification by flash chromatography (50:1 CH2Cl2–MeOH) afforded the title compound (60 mg, 50%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 8.09 (d, J = 9.2 Hz, 2H), 7.50𠄷.33 (m, 7H), 5.45 (s, 1H), 3.80𠄳.70 (m, 2H), 3.61 (d, J = 11.2 Hz, 1H), 3.57𠄳.49 (m, 1H), 3.32𠄳.21 (m, 1H), 1.20 (s, 3H), 0.89 (s, 3H) 13 C NMR (100 MHz, CDCl3) δ 154.3, 145.8, 137.7, 129.5, 128.4, 126.4, 125.4, 122.6, 102.1, 82.8, 78.3, 44.1, 31.9, 21.1, 18.7 MS (ESI+) calcd for C19H22N2O7SNa [M+Na] + 445.1, found 444.8.

4.1.20. 5′-Amino-5′-deoxy-5′-N-[N-((R)-2,2-dimethylbutane-1,3-diol-4-yl)sulfamoyl] adenosine (5)

To a mixture of 26 (120 mg, 0.28 mmol, 1.0 equiv) and 27 33 (167 mg, 0.56 mmol, 2.0 equiv) in CH2Cl2 (10 mL) at 23 ଌ was added 4Å molecular sieves (80 mg) and Et3N (0.40 mL, 2.80 mmol, 10 equiv). The reaction was stirred for 24 h, then filtered and the filtrate concentrated. Purification by flash chromatography (40:1 CH2Cl2–MeOH) afforded 5′-amino-5′-deoxy-5′-N-(N-<[(2R,4R)-5,5-dimethyl-2-phenyl-1,3-dioxan-4-yl]methylamino> sulfamoyl)-2′,3′-O-isopropylideneadenosine (100 mg) as a white solid. The compound was dissolved in 80% aqueous TFA (2 mL) at � ଌ. After stirring 4 h at � ଌ, the solution was concentrated in vacuo. Purification by flash chromatography (10:1 CH2Cl2–MeOH) afforded the title compound (5 mg, 4% yield from 26) as a white solid: 1 H NMR (400 MHz, CD3OD) δ 8.28 (s, 1H), 8.23 (s, 1H), 5.90 (d, J = 6.8 Hz, 1H), 4.91𠄴.89 (m, 1H), 4.36 (dd, J = 5.2, 2.0 Hz, 1H), 4.32𠄴.28 (m, 1H), 3.64𠄳.55 (m, 2H), 3.40𠄳.34 (m, 3H), 3.16 (dd, J = 12.4, 2.0 Hz, 1H), 2.85 (dd, J = 12.8, 10.0 Hz, 1H), 0.81 (s, 3H), 0.78 (s, 3H) 13 C NMR (100 MHz, CD3OD) δ 157.6, 153.9, 150.0, 142.5, 121.2, 91.6, 85.9, 76.3, 74.3, 73.0, 70.2, 46.1, 45.8, 39.6, 21.8, 20.1 HRMS (ESI–) calcd for C16H26N7O7S [M–H] – 460.1620, found 460.1635.

4.2 Pantothenate Synthetase Assay

4.2.1. Materials

Pantoic acid was synthesized as described by Rychlik, 42 7-methyl-6-thioguanosine (MesG) was purchased from Berry and Associates (Dexter, MI, USA), E. coli TOPO and BL21(DE3) cells are from Invitrogen (Carlsbad, CA, USA), restriction enzymes and Taq polymerase are from New England Biolabs (Ipswich, MA, USA), the vectorpET28b is from EMD Biosciences (San Diego, CA, USA), the primers for PCR are from Integrated DNA Technologies (Coralville, IA, USA) and the PFU polymerase is from Agilent Technologies (Wilmington, DE, USA). All other chemicals, biological buffers, and the coupling enzymes inorganic pyrophosphatase (I1643) and purine nucleoside phosphorylase (N8264) were purchased from Sigma-Aldrich (St. Louis, MO).

4.2.2. Cloning, Expression and Purification of Recombinant PanC from Mycobacterium tuberculosis

PanC (Rv3602c) was amplified from the H37Rv BAC Rv222 using PFU turbo and the primers GCGAGCAACCACATCGTCAC and CGACTTCAGCATCGTCCGTAAC. The PCR product was treated with Taq using standard procedures to add 3′ overhanging adenosine residues and then cloned into pCR2.1-TOPO. The resulting plasmid (pCDD22) was used as template to amplify the expression construct using the primers GG CATATG ACGATTCCTGCGTTCCATCCC and GCTC AAGCTT CAGTTTCTCCAATGTGATTCGAGGATTGCCCGG containing the restriction sites NdeI and HindIII respectively (underlined). The resulting PCR product was cloned into pCR2.1 giving plasmid pCDD23. The construct was digested using NdeI and HindIII and ligated into similarly digested pET28b yielding pCDD24. The recombinant plasmid pCDD24 was transformed into E. coli BL21 (DE3) electrocompetent cells and streaked-out on a Luria Bertani (LB) agar plate with 100 μg mL 𢄡 of kanamycin and incubated overnight at 37 ଌ. A single colony was selected to inoculate 50 mL of LB with 100 μgmL 𢄡 of kanamycin to be used as a starting culture.

Terrific Broth (TB) cultures (4 L) were supplemented with 100 μg mL 𢄡 kanamycin, and 10 mL of an overnight starting culture added to the media. The cultures were grown at 37 ଌ until an OD600 of 0.5 and then induced with 0.5 mM of isopropyl β-D-1-thiogalactopyranoside (IPTG) for 4 h at 30 ଌ. The cells were centrifuged at 6000g for 30 min and the pellets were stored at � ଌ. The frozen pellets were thawed in lysis buffer (50 mM HEPES, 300 mM NaCl, 10 mM imidazole, pH 8.0) and the cells were disrupted by sonication on a Branson Sonifier (5 × 2min, 30% duty cycle, power 8) and centrifuged for 30 min at 50,000g to remove cell debris. To the supernatant was added 1 mL of 50% Ni-NTA agarose resin in 30% ethanol (Qiagen) and the final solution was incubated at 4 ଌ for 1 h. The sample was then loaded onto a gravity column and the resin was washed with 15 mL of wash buffer (50 mM HEPES, 300 NaCl, 20 mM imidazole, pH 8.0) and eluted with 2.5 mL of elution buffer (50 mM HEPES, 300 NaCl, 250 mM imidazole, pH 8.0). In order to remove the imidazole from the sample, a desalting column (PD-10, GE HealthCare, Piscataway NJ, USA) was used with the storage buffer (10 mM HEPES [pH 8.0], 1 mM EDTA, 5% glycerol). Protein concentrations were determined using ε280 = 15,930 M 𢄡 cm 𢄡 for the native PanC with a hexa-histidine tag and the final yield of this protocol provided approximately 45 mg per liter of cell culture.

4.2.3. In vitro Inhibition Studies

Kinetic studies to evaluate PanC inhibition of each compound were performed under initial velocity conditions using the MesG coupled assay (EnzChek pyrophosphatase assay, Invitrogen) with 400 nM PanC, 100 mM HEPES (pH 8.0), 2.4 mM β-alanine, 10 mM MgCl2, 0.04 unit of pyrophosphatase, 0.1 unit of purine nucleoside phosphorylase, 0.2 mM 7-methyl-6-thioguanosine (MesG) and varying concentrations of inhibitor, pantoic acid, and ATP in a total volume of 100 μL containing up to 5% DMSO. Reactions were initiated by addition of PanC. In this coupled assay, pyrophosphate generated from the PanC reaction is converted to phosphate by pyrophosphatase. Purine nucleoside phosphorylase then catalyzes the phosphorolysis of the substrate 7-methyl-6-thioguanosine (MesG) to the chromogenic product 7-methyl-6-thioguaninethat is measured by an increase in absorbance at 360 nm. Experiments were performed in 96-well plates (UV Half Area plate with Transparent Bottom-Corning) and formation of 7-methyl-6-thioguaninewas measured at 360 nm (ε360 = 11,000 M 𢄡 cm 𢄡 ) at 25 ଌ on a microplate reader.

For experiments to determine the apparent inhibition constants with respect to pantoic acid, the initial rates were measured at varying concentrations (50, 100, 130, 180, 240 and 300μM) of pantoic acid with 2.6 mM ATP and 2.4 mM β-alanine at different fixed levels of the inhibitors [inhibitor 1a (0, 0.4, 0.8 and 1 μM), inhibitor 2 (0, 0.08, 0.12 and 0.16 μM), inhibitor 3 (0, 0.2, 0.4 and 0.6 μM), inhibitor 4 (0, 0.2, 0.4 and 0.5 μM) and inhibitor 5 (0, 0.8, 1.6 and 2 μM)]. Inhibition data were fit to equation 1:

where I is the inhibitor concentration, S is the substrate concentration, Km is the Michaelis-Menten constant, Vmax is the maximal velocity, Ki is the competitive inhibition constant. 37

4.3. Modeling Studies

The three-dimensional structures of the aforementioned compounds were constructed using Chem. 3D ultra 12.0 software [Chemical Structure Drawing Standard Cambridge Soft corporation, USA (2010)], which were then energetically minimized by using Tripos force field with 5000 iterations and minimum RMS gradient of 0.05 prior to docking. The crystal structures of pantothenate synthetase (M. tuberculosis. and E. coli) (PDB code: 3IVG.pdb) complex were retrieved from the RCSB Protein Data Bank (http://www.rcsb.org/pdb/home/home.do). All bound waters were eliminated from the protein and hydrogens were added to the protein. Each ligand was docked into the active site of pantothenate synthetase using the Surflex-Dock suite of SYBYL 1.3.

4.4. Mtb whole-cell assays

Whole-cell screening of 1𠄵 was carried out against wildtype H37RvMA 43 and the panC-depleted strain as previously described. 38 Briefly, cells were grown to an OD600 of

0.2 in 7H9 medium prior to 500-fold dilution. In the case of the panC knockdown, the medium was supplemented with Hygromycin B (Hyg 50 μg/mL), Kanamycin (Km 25 μg/mL) and Gentamicin (Gm 5 μg/mL) in order to facilitate maintenance of the regulatory vectors. Using a starting concentration of 4 mM, 2-fold serial dilutions of each inhibitor were performed in 96-well microplates containing 50 μL 7H9 medium, supplemented with Hyg (25 μg/mL), Km (12.5 μg/mL) and Gm (2.5 μg/mL) where appropriate, in both the presence and absence of anhydrotetracycline (ATc 20 ng/mL) alone or ATc (20 ng/mL) together with pantothenate (50 μg/mL). A volume of 50 μL of the diluted cell suspension was added to each well, yielding a final volume of 100 μL per well. Plates were incubated at 37 ଌ and growth was observed visually following 7, 10 and 14 days of incubation.

Reagents and conditions: (i) LiAlH4, THF, 0 ଌ, 2 h, 58% (ii) PhCH(OEt)2, CSA, CH2Cl2, reflux, 24 h, 85% (iii) TsCl, Et3N, CH2Cl2, 16 h, 83% (iv) NaN3, DMF, reflux, 16 h, 93% (v) H2, Pd/C, MeOH, 2 h, 75% (vi) 4-nitrophenyl chlorosulfate, CH2Cl2, � ଌ, 2 h, 50% (vii) 27, Et3N, CH2Cl2, 4 Å molecular sieves (viii) 4:1 TFA–H2O, � ଌ, 4 h, 4% from 26.



Comments:

  1. Felis

    I confirm. I subscribe to all of the above. Let's discuss this issue.

  2. Meztirisar

    All not so simply

  3. Nezahualcoyotl

    I think you are making a mistake. Let's discuss this. Email me at PM.

  4. Dirck

    It's even more cheerfully :)

  5. Fercos

    I think you are wrong. I propose to discuss it. Email me at PM.



Write a message