Information

Regarding apoptosis and turning it 'back on'

Regarding apoptosis and turning it 'back on'


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Is there some chemical or chemicals or even special molecules that can be 'injected' into cancer cells that will turn any Apoptosis mechanisms 'back on'?

Or maybe chemicals and/or molecules that might cause a certain gene or set of genes to switch to a configuration favorable to apoptosis?


Yes, tons of things induce apoptosis. Here is a good list that you can get for research grade

Sigma-Aldrich

Even your immune system can tell cells to "commit suicide." Now the trick is, getting drugs, proteins, pathways, and your immune system to selectively target cancer cells.


What is the difference between necrosis and apoptosis?

A number of cell death events have been identified (PMID: 29362479 (1)). They are classified into two groups: programmed/regulated cell death (most commonly known as apoptosis, but also autophagy & necroptosis) and accidental cell death due to non-physiological states such as infection or injury (necrosis).

Apoptosis definition – programmed/regulated cell death

What is apoptosis? Apoptosis is the most common form of programmed cell death. It can be triggered via various physical, chemical, and biological factors, and its cellular response is tightly regulated. The controlled degradation of cellular components that occurs during apoptosis is regulated by caspases, which are a family of proteases activated during apoptosis (more details here: Caspase family).

In healthy cells, caspases exist as proenzymes in their inactive forms. Apoptotic signaling activates a caspase cascade (caspase -2,-8, -9, and -10, called initiator caspases). Next, the initiator caspases in turn cleave and activate downstream effector caspases (caspase -3, -6, and -7). Effector caspases execute apoptosis by cleaving targeted cellular proteins. Stimuli initiating apoptosis can be internal (e.g., DNA damage, ER stress, increased ROS levels, cell defects during mitosis), or external, whereby extracellular stimuli are detected by cells via plasma membrane receptors (more details here: Caspase cascade).

Extrinsic apoptosis

There are two main receptor types for externally induced apoptosis. Death receptors (e.g., TNF, Fas receptors) bind their extracellular ligands (TNF-alpha, FasL – Fas ligand, respectively). This prompts their activation and assembly into complexes, leading to the activation of intracellular caspases. The other apoptotic receptors are called dependence receptors (e.g., DCC and PTCH1), which on a completely opposite sensing mechanism. In physiological conditions, they respond to trophic factors and act as an anti-apoptotic stimulus. However, when their ligand falls below a certain level in the extracellular space, ligand-free receptors trigger the apoptotic response.

Intrinsic apoptosis

Intrinsic apoptosis is mediated by mitochondria-associated BCL-2 family proteins – BAX and BAK (BAX antibody: 50599-2-Ig). BAK is a transmembrane protein of the outer mitochondrial membrane. Upon apoptosis induction, BAX undergoes conformational change. This exposes its transmembrane domain, leading to the insertion of BAX into the outer mitochondrial membrane. BAX-BAK heterodimers form mitochondrial pores, which leads to the release of mitochondrial proteins into the cytoplasm, including cytochrome c and DIABLO proteins, that can activate caspases.

Changes during apoptosis

Apoptosis is reflected in significant cell morphological changes (Table 1). In the earlier phases, a cell undergoing apoptosis loses cell contacts and changes shape. Chromatin condenses in the nucleus and moves toward the nuclear envelope. Condensation of the nucleus (pyknosis) initiates DNA degradation. Loss of water results in significant cell shrinkage and blebbing of the plasma membrane with little or no morphological changes to the other cellular organelles. Phosphatidylserine, a lipid present only in the inner layer of the plasma membrane, is now also visible in the outer layer. Nucleus and cytoplasm fragment into apoptotic bodies. Released cellular proteases lead to disintegration of the cellular skeleton, membranes, and proteins. Neighboring macrophages recognize, engulf, and digest apoptotic bodies, completing the process.

Necrosis definition- unregulated cell death

What is necrosis? Necrosis is a form of cell injury defined as unregulated cell death resulting from internal or external stresses such as mechanistic injuries, chemical agents, or pathogens. The process is usually rapid and leads to cell swelling (oncosis) and bursting due to loss of osmotic pressure (Table 1).

Changes during necrosis

During necrosis, the loss of plasma membrane integrity induces cellular contents to escape to the extracellular space, causing inflammatory responses. Cell disintegration is preceded by a series of morphological changes, including disruption of cell organelles, such as swelling of the ER and mitochondria, or decay of the Golgi apparatus. An influx of calcium ions from the extracellular matrix activates intracellular nucleases that fragment DNA. Freed lysosomal hydrolases contribute to the degradation of nucleic acids and proteins. Decay products activate leukocytes, lymphocytes, and macrophages that phagocytose the remnants of dead cells.

Necroptosis – regulated necrosis

Necroptosis is a form of regulated cell death that produces necrotic phenotype. It arises in response to stress stimuli (PMID: 19524512 (6), 19524513 (7), and 19498109 (8)) such as interferons, death ligands, or Toll-like receptors. Activation is mediated through protein 3 interacting receptor (RIP3, also known as RIPK3), a serine-threonine kinase (Figure 4). Cells in the initial stages of necroptosis are characterized by RIP3 phosphorylation and commonly β-amyloid-like protein complex formation with RIP1, known as necrosome. Phosphorylated RIP3 acts downstream by phosphorylation of MLKL (Figure 5), which causes necrosis by a mechanism that is yet to be fully understood (PMID: 30131615 (9)).

Figure 4. IP Result of anti-RIP3 antibody (IP:17563-1-AP, 3ug Detection:17563-1-AP 1:300) with SW 1990 cells lysate 3000ug.

Figure 5. Immunofluorescence analysis of (-20℃ Ethanol) fixed HepG2 cells using 21066-1-AP (MLKL antibody) at dilution of 1:50 and Alexa Fluor 488-conjugated AffiniPure Goat Anti-Rabbit IgG(H+L).

Autophagy definition – a rare type of programmed cell death

Autophagy is a natural degradation process of cellular contents during nutrient stress. In the case of macro-autophagy, it involves the formation of double membrane vesicles called autophagosomes that fuse with lysosomes to form autolysosomes. This process is initiated by the mechanistic target protein of rapamycin (mTOR) and autophagy-related genes (Atgs) proteins (Figures 1-2). Autophagy promotes cell survival, providing starved cells with nutrients obtained through the digestion of non-essential cellular components.

It was discovered that macro-autophagy can also be one of the routes for programmed cell death (PMID: 22052193 (2)). Although significantly less common than apoptosis, it plays a role in regulating some developmental processes. The most well known is the removal of certain larval organs – the salivary glands and midgut – in Drosophila melanogaster during larval–pupal transition (PMID:18083103 (3) and 19818615 (4)). Autophagic cell death was also observed in in vitro cultures of adult hippocampal neural cells in response to insulin removal (PMID: 18653772 (5)). The main characteristic of autophagy-dependent cell death is extensive autophagic vacuolization of the cytoplasm, with no changes in chromatin organization as seen in apoptosis (Table 1). Also, cell remnants are not cleared by macrophagic phagocytosis as observed in apoptosis. Autophagy leads to autophagic cell death that can be blocked by inhibitors or the depletion of Atg proteins (e.g., Atg1, Atg5, Atg7) (Figure 3).

Figure 1. Immunohistochemical analysis of paraffin-embedded human colon cancer tissue slide using 10181-2-AP (ATG5 antibody) at dilution of 1:200 (under 40x lens).

Figure 2. Immunohistochemical analysis of paraffin-embedded human skeletal muscle tissue slide using 20986-1-AP (ULK1 Antibody) at dilution of 1:200 (under 40x lens).

Figure 3. WB result of ATG5 antibody (10181-2-AP 1:1000 incubated at room temperature for 1.5 hours) with sh-Control and sh-ATG5 transfected HepG2 cells.

Final remarks

The two main types of cell death are apoptosis and necrosis. They differ in terms of the stimuli that initiate cell death processes, morphological and biochemical changes, and in the signaling routes used by cells.

Necrosis is caused by external factors that lead to irreversible cell injury, with loss of plasma membrane integrity and rapid death often resulting in activation of the immune system. In contrast, apoptosis is initiated by a number of internal and external routes it is a well-controlled process that results in the slow turnover of cell remnants and phagocytosis by neighboring macrophages.

Table 1. Physiological events during apoptosis, autophagy, and necrosis.
Apoptosis
Autophagy
Necrosis
Morphological changes

Shrinkage and loss of cell-cell contacts apoptotic cells phagocytose neighboring cells

Extensive vacuolization of the cytoplasm

Plasma membrane

Blebbing with intact cell integrity, formation of apoptotic bodies at late stages

Loss of integrity increased permeability

In some cases, enlargement of Golgi and ER is observed

Chromatin condensation, fragmentation

No chromatin condensation

Condensation of chromatin and disintegration of the nucleus

Mitochondrion

Potential membrane changes, swelling

Swelling sometimes observed

Non-functional, swelling and fragmentation

Biochemical changes

Endonuclease-induced cleavage to fragments of specific lengths (DNA laddering)

Random degradation of genomic DNA

Kinases activation phosphatases, caspases, and nucleases

Enzymatic degradation in autophagosomes

Anti-apoptotic proteins

Bcl-2 family proteins, Inhibitor of Apoptosis Proteins (IAPs), caspase inhibitors


Tumor-promoting function of apoptotic caspases by an amplification loop involving ROS, macrophages and JNK in Drosophila

Apoptosis and its molecular mediators, the caspases, have long been regarded as tumor suppressors and one hallmark of cancer is 'Evading Apoptosis'. However, recent work has suggested that apoptotic caspases can also promote proliferation and tumor growth under certain conditions. How caspases promote proliferation and how cells are protected from the potentially harmful action of apoptotic caspases is largely unknown. Here, we show that although caspases are activated in a well-studied neoplastic tumor model in Drosophila, oncogenic mutations of the proto-oncogene Ras (Ras V12 ) maintain tumorous cells in an 'undead'-like condition and transform caspases from tumor suppressors into tumor promotors. Instead of killing cells, caspases now promote the generation of intra- and extracellular reactive oxygen species (ROS). One function of the ROS is the recruitment and activation of macrophage-like immune cells which in turn signal back to tumorous epithelial cells to activate oncogenic JNK signaling. JNK further promotes and amplifies caspase activity, thereby constituting a feedback amplification loop. Interfering with the amplification loop strongly reduces the neoplastic behavior of these cells and significantly improves organismal survival. In conclusion, Ras V12 -modified caspases initiate a feedback amplification loop involving tumorous epithelial cells and macrophage-like immune cells that is necessary for uncontrolled tumor growth and invasive behavior.

Keywords: D. melanogaster Reactive oxygen species Scrib apoptosis cancer biology caspase hemocyte oncogenic ras.

Conflict of interest statement

No competing interests declared.

Figures

Figure 1.. Both intra- and extracellular ROS…

Figure 1.. Both intra- and extracellular ROS contribute to the strong neoplastic phenotype of scrib…

Figure 1—figure supplement 1.. Caspase-dependent generation of…

Figure 1—figure supplement 1.. Caspase-dependent generation of ROS as revealed by H 2 DCF-DA labelings.

Figure 1—figure supplement 2.. Strong induction of…

Figure 1—figure supplement 2.. Strong induction of β-Gal by expression of UAS-lacZ in scrib −/−…

Figure 2.. Caspases are required for ROS…

Figure 2.. Caspases are required for ROS generation and neoplastic overgrowth in scrib −/− Ras…

Figure 3.. Analysis of caspase activity and…

Figure 3.. Analysis of caspase activity and apoptosis in scrib −/− Ras V12 mosaic eye…

Figure 3—figure supplement 1.. Reduction of ROS…

Figure 3—figure supplement 1.. Reduction of ROS results in loss of caspase activity in scrib…

Figure 4.. Caspase-generated ROS are required of…

Figure 4.. Caspase-generated ROS are required of recruitment and activation of hemocytes to scrib −/−…

Figure 5.. JNK acts upstream and downstream…

Figure 5.. JNK acts upstream and downstream of caspase activation and ROS generation.

Figure 5—figure supplement 1.. MMP1 labeling is…

Figure 5—figure supplement 1.. MMP1 labeling is reduced in scrib −/− Ras V12 clones with…

Figure 6.. Mechanistic view about the conversion…

Figure 6.. Mechanistic view about the conversion of caspases from tumor suppressors to tumors promoters…


Materials and Methods

Cell Culture and Apoptosis Assays

Primary mouse mammary cells, isolated from pregnant ICR mice (Pullan and Streuli 1996), and FSK-7 cells (Kittrell et al. 1992), were grown in DMEM/F12 supplemented with 2% fetal calf serum, 5 ng/ml epidermal growth factor and 880 nM insulin. To assay detachment-induced apoptosis, confluent cells were trypsinized and replated in whole medium onto dishes coated with polyhydroxyethylmethacrylate (poly-HEMA). In the case of inhibitor experiments, cells were preincubated with inhibitors 1 h before trypsinization and throughout incubation on poly-HEMA. Inhibitors were obtained from Calbiochem and used at the following concentrations: cycloheximide was used at 25 μg/ml, zVAD-fmk, and Ac-DEVD-cmk at 100 μM, herbimycin A at 1 μM, and wortmannin at 1 μM pervanadate was used at 1 mM from sodium orthovanadate and hydrogen peroxide (Sigma), and treated with catalase (Sigma) to quench unreacted hydrogen peroxide. After incubation for various times, cells were cytospun onto polysine slides (Merck), and fixed in 2% paraformaldehyde. To quantify apoptosis, nuclear morphology was examined after staining cells with 4 μg/ml Hoescht 33258 (Molecular Probes). To analyze DNA integrity after incubation on poly-HEMA, cells were washed in PBS and lysed in 100 mM NaCl, 10 mM EDTA, 25 mM Tris-Cl, pH 8.0, 0.65% SDS, and 500 μg/ml proteinase K. Lysates were extracted with phenol/chloroform (1:1). DNA was ethanol precipitated, treated with RNase and separated on a 1.5% agarose gel containing ethidium bromide.

Protein Extraction and Immunoblotting

For fractionation studies, cells were washed once in PBS before resuspending in hypotonic buffer (10 mM NaCl, 1.5 mM MgCl2, 10 mM Tris-Cl, pH 7.6, 1 mM NaFl, and 100 μM sodium orthovanadate, containing protease inhibitors) and lysed in a Dounce homogenizer before addition of 5× isotonic buffer (525 mM mannitol, 172 nM sucrose, 12.5 mM Tris-Cl, pH 7.6, and 2 mM EDTA). Cytosolic and membrane fractions were then centrifuged at 100,000 g. Equivalent amounts of protein were separated by SDS-PAGE and immunoblotted (Metcalfe et al. 1999). For cross-linking experiments, after incubations, cells were washed in PBS twice before incubating with 2.5 mM disuccinimidyl suberate (Pierce) in 200 mM mannitol, 70 mM sucrose, 1 mM EDTA, and 10 mM Hepes, pH 7.5, for 30 min. The reaction was stopped by adding Tris-Cl, pH 7.6, to 20 mM. The total lysates were boiled in SDS-PAGE sample buffer and immunoblotted with polyclonal anti-Bax 62M (Metcalfe et al. 1999), anti-calnexin (Stress Gen), and anti-active caspase 3 (a kind gift from Anu Srinvasan, Idun Pharmaceuticals, Inc., La Jolla, CA), and monoclonal rat anti-Bax (PharMingen), mouse anti�l-x (Transduction laboratories), and mouse anti-COX I (Molecular Probes).

Microinjection

GST fusion proteins were expressed in E. coli and purified on glutathione-agarose (Sigma) as previously described (Gilmore and Romer 1996). FSK-7 cells were grown to confluence on coverslips before microinjecting with either GST alone or with the GST-tagged dominant negative pp125FAK (DN-FAK) fusion protein at 3 mg/ml in 75 mM KCl, and 10 mM potassium phosphate, pH 7.5. Cells were fixed in 2% paraformaldehyde either 1 or 5 h postinjection before immunostaining.

Transient Transfections

The plasmid pSG5.p110CAAX was a generous gift of Dr. Julian Downward (ICRF, London, UK). TS-pp60src was kindly given by Dr. Ged Brady (University of Manchester, Manchester, UK). Both were subcloned into the expression vector pCDNA.3 to produce pCDNA.3/p110CAAX and pCDNA.3/src. pCMV3RΔp85 (referred to in text as p85ΔSH2) was kindly provided by Dr. Phill Hawkins (Babraham Institute, Cambridge, UK). Full-length murine Bax was cloned by PCR using pfu DNA polymerase (Stratagene) from RNA isolated from adult mouse mammary gland using PCR primers directed against the 5′ and 3′ ends of the coding sequence. HA-tagged Bax and Bax truncated at its carboxyl terminus at residue 172 (Bax㥌T) were generated by PCR using the 5′ primer ATGTACCCATACGACGTCCCAGACTACGCCATGGACGGGTCC, incorporating the HA epitope tag. TCAGCCCATCTTCTTCCAGAT was used as the 3′ primer for Bax, and TCACTGCCATGTGGGGGTCCC for Bax㥌T. Both were cloned into pCR-script SK+ (Stratagene) and confirmed by double stranded sequencing, before subcloning into pCDNA.3 to produce pCDNA.3/HA-Bax and pCDNA.3/HA-Bax㥌T. GST-tagged DN-FAK (amino acids 839-1052) was amplified by PCR using the 5′ primer GCCGCCATGTCCCCTATACTA, and the 3′ primer TCAGTGTGGCCGTGTCTG, and cloned into pCDNA.3.

FSK-7 cells plated onto coverslips at 1 × 10 5 cells/cm 2 were grown to 80�% confluence before transfecting using lipofectamine plus (GIBCO BRL). Cells were transfected with a total of 3 μg DNA. For cotransfections, 2 μg of pCDNA.3/DN-FAK was used with 1 μg of pCDNA.3, pCDNA.3/p110CAAX or pCDNA.3/src. Cells were transfected for 3 h followed by 18 h incubation in growth medium. Detached cells were collected and cytospun onto polysine-coated slides. Both the adherent and the detached cells were immunostained. DN-FAK– or p85ΔSH2-expressing cells with apoptotic morphology were counted.

Immunofluoresence

Cells were fixed in 2% paraformaldehyde in PBS and permeabilized in 0.5% Triton X-100. Cells were stained with anti-Bax 62M, anti-GST (Pharmacia) or the p85 subunit of PI 3-kinase (Upstate Biotechnology Inc.) in PBS with 0.1% horse serum, followed by either Cy2- or Cy3-conjugated secondary antibodies (Jackson Laboratories). Cells were counterstained with 4 μg/ml Hoescht 33258. Cells were viewed on a Zeiss Axiophot photomicroscope equipped with epifluorescence and images were taken on T-MAX 400 film. For comparison of Bax staining, all exposures and subsequent image manipulations were identical. For visualization of mitochondria, cells were incubated for 15 min before fixation with 500 nM Mitotracker green-fm (Molecular Probes).


The process of angiogenesis plays an important role in many physiological and pathological conditions. Inhibition of endothelial cell (EC) apoptosis providing EC survival is thought to be an essential mechanism during angiogenesis. Many of the angiogenic growth factors inhibit EC apoptosis. In addition, the adhesion of ECs to the extracellular matrix or intercellular adhesion promotes EC survival. In contrast, increasing evidence suggests that the induction of EC apoptosis may counteract angiogenesis. In this review, we focus on the regulation of EC survival and apoptosis during angiogenesis and especially on the effects and intracellular signaling promoted by angiogenic growth factors, endogenous angiogenic inhibitors (such as angiostatin, endostatin, and thrombospondin-1), and the adhesion to the extracellular matrix. Furthermore, we discuss the effects of cross talk between adhesion molecules and growth factors. Understanding the molecular mechanisms involved in the regulation of EC survival and apoptosis may provide new targets for the development of new therapies to enhance angiogenesis in the case of tissue-ischemia (eg, the neovascularization of myocardium) or to inhibit angiogenesis in the case of neovascularization-dependent disease (eg, tumor, diabetic retinopathy).

Angiogenesis refers to the formation of new capillaries from preexisting vessels. 1 Angiogenesis plays an essential role in physiological processes such as embryonic development, the menstrual cycle, and in pathologic conditions (eg, wound healing, tumor growth and metastasis, rheumatoid arthritis, proliferative diabetic retinopathy, atherosclerosis, and postischemic vascularization of the myocardium). 2 The process of angiogenesis consists of several steps, which include the stimulation of endothelial cells (ECs) by growth factors, the subsequent degradation of the extracellular matrix by proteolytic enzymes followed by invasion of the extracellular matrix, migration and proliferation of ECs, and finally the formation of new capillary tubes. Eventually, the recruitment of periendothelial cells (pericytes) stabilizes the newly formed capillary network. 1

The initiation of angiogenesis, the angiogenic switch, is dependent on a dynamic balance between proangiogenic and antiangiogenic factors in the immediate environment of ECs. 3 A positive balance in favor of angiogenic factors leads to new vessel formation, whereas the prevalence of antiangiogenic factors shifts the equilibrium to vessel quiescence or, under particular circumstances, even to vessel regression. 3 Inhibition of EC apoptosis providing EC survival is thought to be an essential issue during angiogenesis. In contrast, increasing evidence suggests that the induction of EC apoptosis may counteract angiogenesis. In this review, we focus on the regulation of EC survival and apoptosis during angiogenesis and especially on the effects and intracellular signaling promoted by angiogenic growth factors, angiogenic inhibitors, and the adhesion to the extracellular matrix.

Angiogenic Growth Factors and EC Survival

EC survival is maintained by growth factors and by contact to the extracellular matrix. Growth factor deprivation leads in vitro to programmed cell death of ECs. Several endothelial growth factors, such as vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), and angiopoietin-1 are known to provide EC survival by inhibiting EC apoptosis (Figure 1).

Figure 1. Regulation of EC apoptosis by angiogenic factors. VEGF, angiopoietin-1, and bFGF modulate apoptosis by regulation of gene expression and post-transcriptional regulation of protein kinases. The question mark indicates that the pathway was demonstrated in other cell types, but its causal contribution in ECs is not clear.

VEGF is a potent EC mitogen and key regulator of both physiological and pathological (eg, tumor) angiogenesis. VEGF exerts its angiogenic effects by binding to the VEGF-receptor tyrosine kinases VEGF-receptor 1 (VEGFR1, flt-1) and VEGF-receptor 2 (VEGFR2, flk/KDR). VEGF has been shown to induce EC migration and proliferation and to increase vascular permeability. 4 VEGFR2-deficient or VEGF-deficient mice fail to develop a vascular system, have very few ECs, and die during embryonic development. 5–7

An important angiogenic and vasculoprotective property of VEGF is the promotion of EC survival by inhibiting apoptosis. Alon et al 8 first demonstrated in a model of hyperoxia-induced retinopathy of neonatal rats that hyperoxia-induced downregulation of VEGF expression in the neonatal rat retina leads to the regression of retinal capillaries via selective apoptosis of ECs. This apoptotic effect on ECs could be prevented by the intraocular injection of VEGF, establishing a role for VEGF as an in vivo EC survival factor. 8 Moreover, the inhibition of VEGF leads to apoptosis of ECs and vessel regression in several models of tumor angiogenesis. 9–12 Developmental investigations have indicated that VEGF survival function is only required until the vessel comes in contact with pericytes. Even in an animal model consisting of xenografted tumors with tetracycline-regulated VEGF expression, abrupt VEGF withdrawal leads to selective apoptosis of ECs in immature tumor vessels (newly formed vessels devoid of periendothelial cells) and subsequently to vessel regression, whereas mature tumor vessels with recruited pericytes seem to be resistant to VEGF withdrawal-induced apoptosis and regression. 11 Thus, mature, pericyte–covered vessels are less sensitive to alterations of the VEGF level for both proliferation and regression.

In vitro experiments have demonstrated that VEGF inhibits EC apoptosis that is induced by growth factor deprivation 13,14 and tumor necrosis factor-α (TNF-α) stimulation. 15 Recent investigations have provided more insight into the antiapoptotic signaling that is mediated by VEGF (Figure 1). VEGF was shown to induce the expression of antiapoptotic proteins such as Bcl-2, 13,16 A1, 13 survivin, and XIAP. 17 The targeting of survivin by antisense oligonucleotides abolished the antiapoptotic function of VEGF against TNF-α– or ceramide-induced cell death and induced regression of capillary tubes in a 3-dimensional angiogenic assay. 18 In contrast, the inhibition of survivin had no effect on the stimulatory effect of VEGF on EC migration. 18

Furthermore, VEGF was shown to promote EC survival by activation of the phosphatidylinositol 3-kinase (PI3K)/Akt pathway. 14,19 Pharmacological inhibition of PI3K or transfection with a dominant-negative Akt mutant abolished the antiapoptotic effect of VEGF on ECs. Interestingly, the survival effect of VEGF was dependent on the binding of VEGF on the VEGFR2 (KDR/flk-1), whereas VEGFR1-specific ligands (such as PlGF) did not promote survival of ECs. 19 These findings have identified the VEGFR2 and the PI3K/Akt signal transduction pathway as crucial elements in the promotion of EC survival induced by VEGF. The downstream effector pathways mediating the antiapoptotic VEGF effect include Akt-dependent activation of the endothelial nitric oxide synthase (NOS), 20,21 resulting in an enhanced endothelial NO synthesis. Endothelial NO in turn promotes EC survival, as demonstrated by in vitro studies as well as in studies with ECs from endothelial NOS (eNOS)−/− mice. 22,23 Alternatively, the PI3K/Akt pathway also upregulates the transcription of survivin 24 and can inhibit the p38 mitogen-activated protein kinase (MAPK). 25 Finally, Gupta et al 26 demonstrated that the VEGF-induced activation of the MAPK/extracellular signal–regulated kinase (ERK) pathway and inhibition of the stress-activated protein kinase/c-Jun amino-terminal kinase pathway is also implicated in the antiapoptotic effect mediated by VEGF. Interestingly, the activation of the PI3K/Akt pathway mediates not only the survival effect but also the migratory effect of VEGF on ECs via Akt-dependent phosphorylation and activation of eNOS. 27 Beyond this, Akt is capable of promoting EC chemotaxis via phosphorylation of the G-protein–coupled receptor EDG-1. 28

Angiopoietin-1

Another endothelial-specific growth factor/growth factor receptor system involved in angiogenesis is the angiopoietin/Tie2 system. Angiopoietin-1 and -2 are the ligands for the Tie2 receptor tyrosine kinase. Angiopoietin-1 stimulation has in contrast to VEGF no mitogenic effect on ECs. 29 Unlike VEGFR2- and VEGF-deficient mice, which fail to develop a primary vascular system, angiopoietin-1– or Tie2-deficient mice reveal a primary vascular plexus, which fails to recruit periendothelial cells (pericytes) and to remodel into a more mature and differentiated vascular system with small and large vessels adapted to the metabolic demands of the tissues. 29–31 These results suggest that angiopoietin-1 and Tie2 receptor are important for the later steps of the angiogenic process, the remodeling, and the maturation of the newly formed vascular system and have a stabilizing effect on the capillaries. In vitro experiments have demonstrated that angiopoietin-1 activation of the Tie2 receptor inhibits EC apoptosis 32,33 and induces EC migration and capillary tube formation. 33 The angiopoietin-1–induced survival effect on ECs is dependent on the activation of PI3K and Akt. 24,34,35 Papapetropoulos et al 24 demonstrated that angiopoietin-1 induces PI3K-dependent activation of Akt and upregulates the antiapoptotic protein survivin, whereas it has no effect on the transcription of Bcl-2. Expression of a dominant-negative Akt mutant or a dominant-negative survivin mutant abolished the antiapoptotic effect of angiopoietin-1 in ECs. Another possible mechanism by which angiopoietin-1 may affect EC survival is the recruitment of pericytes. The constitutive pattern of expression of angiopoietin-1 suggests that angiopoietin-1 has a permissive stabilizing effect on the vascular system. 36 In contrast to angiopoietin-1, angiopoietin-2 does not lead to activation of the Tie2 receptor and it is believed to be a naturally occurring antagonist of the Tie2 receptor. 37 This assertion is supported by the fact that transgenic mice overexpressing angiopoietin-2 demonstrate a phenotype reminiscent of the angiopoietin-1– and Tie2-deficient mice. 37 Angiopoietin-2 is believed to promote a destabilizing effect on capillary vessels by inhibition of the angiopoietin-1 signaling and disruption of the endothelial cell–pericyte interactions and to lead to vessel regression in the absence of VEGF. 36,38 Angiopoietin-2 blocks the angiopoietin-1–induced phosphorylation and activation of Akt. 24 Yu and Stamenkovic 39 demonstrated that angiopoietin-2 overexpression in tumors leads to increased aberrant angiogenic vessels with increased EC apoptosis. Nevertheless, angiopoietin-2 in high concentrations was also demonstrated to promote EC survival in vitro by the activation of the PI3K/Akt pathway. 40

Another important angiogenic factor is bFGF, which inhibits EC apoptosis induced by radiation 41 or growth factor deprivation. 42 As shown for VEGF, bFGF also upregulates the expression of the antiapoptotic proteins Bcl-2 and survivin. 43 The overexpression of Bcl-2 in ECs prevents apoptosis induced by serum and growth factor deprivation, whereas it has no effect on the bFGF-induced EC proliferation. 42 Furthermore, bFGF also activates the protein kinase Akt in ECs. 44

Taken together, various growth factors are involved in the initiation and promotion of angiogenesis and in the maintenance of the vascular network. A common property of these growth factors is the induction of EC survival. The inhibition of EC apoptosis by the distinct growth factors is dependent on PI3K/Akt signaling but may also include the upregulation of apoptosis inhibiting proteins such as survivin and Bcl-2 (seeFigure 1).

Adhesion and EC Survival

Adhesion of ECs to extracellular matrix proteins and intercellular adhesion are essential for EC survival and angiogenesis.

Cell Matrix Interactions

In the absence of any extracellular matrix interactions, ECs rapidly undergo apoptosis, 45 a phenomenon called anoikis. Integrins mediate the adhesion of ECs to extracellular matrix proteins and the EC migration. 46 The interaction of cells via integrins with the extracellular matrix also provides a potent survival signal. In a previous study, programmed cell death was blocked by plating cells on an immobilized integrin beta-1 antibody but not by antibodies to vascular cell adhesion molecule-1, suggesting that integrin-mediated signals were required for maintaining cell viability. 45 Moreover, the attachment of ECs on extracellular matrix proteins as vitronectin or fibronectin reduced the susceptibility of ECs to apoptosis. 47 The vitronectin receptors (ανβ3- and ανβ5-integrin) are expressed during in vivo angiogenesis and are markers of the angiogenic phenotype of ECs. 48,49 Blocking antibodies or antagonistic peptides to ανβ3-integrin, which interrupt the ανβ3-mediated adhesion to extracellular matrix proteins leads to the inhibition of tumor- and growth factor–induced angiogenesis in vivo by selectively inducing apoptosis of ECs in newly formed vessels. 50 Interestingly, the inhibition of ανβ3-integrin ligation did not affect quiescent vessels that are not involved in the angiogenic process. 50 These results suggest that ligation of the ανβ3-integrin is required for the survival of ECs of the angiogenic phenotype. In addition, the antiangiogenic effect exerted by TNF-α and interferon-γ results in a reduced activation of ανβ3-integrin, leading to a decreased ανβ3-integrin–dependent EC adhesion and survival. 51 Surprisingly, genetically engineered mice with an ablation of the αν-subunit gene lacking all five αν-integrins display extensive vasculogenesis and angiogenesis during embryonic development. 52 Likewise, genetic ablation of β3- and β5-integrin subunits results in enhanced hypoxia- and tumor-induced angiogenesis. 53 A possible explanation for this discrepancy could be that the physiological developmental angiogenesis and the postnatal or the pathological angiogenesis are dependent at least in part on distinct molecular mechanisms. Another conceivable explanation is the functional redundancy between different integrins. Indeed, recent knockout studies indicate that other integrins such as β1-, α1-, and α5-integrin also are involved in angiogenesis. 54–57 Furthermore, in vitro studies demonstrated that α1β1- and α2β1-integrins mediate the VEGF-induced angiogenesis and that α5β1-integrin is involved in the shear stress–induced EC migration and survival. 58,59

Various signaling cascades have been considered to mediate the antiapoptotic effect of integrins (Figure 2). Regarding the intracellular signaling mediated by the ανβ3-integrin, Stromblad et al 60 demonstrated that the ligation state of ανβ3-integrin influences p53 activity and the Bax cell death pathway. Ligation of the ανβ3-integrin on ECs suppressed p53 activity, decreased the expression of the cell cycle inhibitor p21 WAF1/CIP1, and increased the Bcl2/Bax ratio, thereby promoting EC survival. 60 Moreover, Scatena et al 61 demonstrated that the attachment of ECs specifically on vitronectin or osteopontin (extracellular matrix proteins that are known ανβ3-integrin ligands) induces nuclear factor kappa B (NFκB) activity. Inhibition of the adhesion by a specific anti–ανβ3-integrin antibody or inhibition of NFκB by overexpression of a nonphosphorylatable IκB blocked the survival effect of ανβ3-integrin ligation. The ανβ3-integrin–induced activation of NFκB was shown to be mediated by the small GTP-binding protein Ras and the tyrosine kinase Src but not by the MAPK or PI3K. Recently, Malyankar et al 62 demonstrated that the ανβ3-integrin–mediated EC survival depends on osteoprotegerin induction by NFκB. The antiangiogenic and apoptotic effect on ECs mediated by inhibition of the ανβ3-integrin was shown to be associated with an increase in the intracellular ceramide level, which may induce apoptosis. 63

Figure 2. Antiapoptotic signaling pathways activated by integrins. Binding of integrins to extracellular matrix proteins (ECM) promotes EC survival by regulation of the expression of apoptosis-related proteins and activation of protein kinase cascades and of growth factor receptors.

Furthermore, various studies suggest an essential role for the PI3K/Akt pathway in the antiapoptotic signaling promoted by integrin–cell matrix interactions. Khwaja et al 64 provided evidence that adhesion to the extracellular matrix induces the PI3K-dependent activation of Akt and that overexpression of a constitutively active PI3K or Akt mutant inhibited detachment-induced apoptosis of epithelial cells (anoikis). The cell adhesion–dependent phosphorylation of Akt on Ser 473 and its activation is mediated by the integrin-linked kinase, a serine/threonine kinase capable of interacting with the cytoplasmic domains of integrin β1-, β2-, and β3-subunits. 65,66 Moreover, Wary et al 67 demonstrated that the association of specific integrins such as the α5β1-, the ανβ3-, and the α1β1-integrin with the adaptor protein Shc can regulate cell survival and cell cycle progression via the Ras/MAPK/ERK pathway.

An interesting issue is that integrin signaling may affect and influence growth factor signaling. Angiopoietin-1, 34 bFGF, 34 or VEGF 14,34 failed to prevent EC apoptosis (anoikis) in suspension culture. However, another study demonstrated an inhibitory effect for angiopoietin-1 on EC apoptosis induced by anchorage disruption. 24 Soldi et al 69 demonstrated that during EC stimulation with VEGF, the ανβ3-integrin co-immunoprecipitates with the VEGFR2. Furthermore, EC adhesion to the ανβ3-integrin ligand vitronectin increases the tyrosine phosphorylation and the biological function mediated by VEGFR2 and that anti–αv- and anti–β3-antibodies inhibit the VEGF–induced phosphorylation of VEGFR2 and the subsequent activation of PI3K, suggesting that ανβ3-integrin ligation may enhance antiapoptotic signaling mediated by VEGF. 68 Inversely, VEGF has been shown to mediate its angiogenic functions through the VEGFR2 by activating various integrins involved in angiogenesis in a PI3K/Akt-dependent manner. 69 EC adhesion mediated by the β1-integrin or αν-integrin also has been shown to induce tyrosine phosphorylation and activation of the EGF receptor even in the absence of EGF receptor ligands and leads to MAPK/ERK activation and EC survival. 70 In conclusion, there is a functional cross talk between integrin- and growth factor–mediated signaling, which may act synergistically to promote EC survival (Figure 2).

Cell-Cell Adhesion

Recent evidence suggests that not only cell matrix contacts but also cell-cell contacts between ECs may support cell survival. For example, platelet EC adhesion molecule-1 (PECAM-1, CD-31) homophilic adhesion rescues ECs from serum deprivation–induced apoptosis, whereas it has no effect on EC migration and proliferation. 71 Furthermore, the VE-cadherin, an adhesive protein contained at endothelial adherens junctions that mediates interendothelial cell adhesion, has been demonstrated to be essential for the VEGF-induced antiapoptotic effect. 44 In detail, targeted inactivation of the VE-cadherin gene or truncation of the β-catenin–binding cytosolic domain of the VE-cadherin in mice caused embryonic lethality by impairing the maturation and remodeling of the initially formatted vascular plexus via apoptosis induction. The VEGF-induced activation of the PI3K/Akt pathway, upregulation of Bcl2, reduction of p53 and p21 expression, and prevention of serum deprivation–induced apoptosis of ECs was abolished by the inactivation of the VE-cadherin gene or by the truncation of the cytosolic β-catenin–binding domain of VE-cadherin, suggesting that VE-cadherin signaling via the β-catenin is essential for the survival signaling mediated by VEGF. 44

Taken together, cell matrix and cell-cell interactions provide EC survival by inhibiting EC apoptosis that acts synergistically to growth factors. This survival signaling is essential for the promotion of angiogenesis.

Angiogenic Inhibitors and EC Apoptosis

Because angiogenesis is the result of a dynamic balance between angiogenic inductors and angiogenic inhibitors, we will focus in the following part of this review article on the regulation of EC apoptosis by endogenous angiogenic inhibitors (Figure 3).

Figure 3. Proposed effector pathways of endogenous angiogenic inhibitors: angiostatin (A), endostatin (B), and TSP-1 (C).

Angiostatin

Angiostatin is a 38-kDa fragment of plasminogen containing kringles 1 to 3, which was purified from mice bearing a Lewis lung carcinoma. 72 Angiostatin was shown to inhibit in vivo tumor angiogenesis and to induce dormancy of tumors in mice by inhibition of the EC proliferation. 73 Angiostatin can be generated by proteolysis of plasminogen by a macrophage–derived metalloelastase 74 and other MMPs 75 or by the reduction of plasmin. 76 Angiostatin exerts its antiangiogenic function at least in part by induction of EC apoptosis. 77–79 Intriguingly, the proapoptotic effect of angiostatin was not restricted to mature ECs. Thus, Ito et al 80 demonstrated an inhibitory effect of angiostatin on the growth of endothelial progenitor cells, which are believed to play a key role in postnatal neovascularization. With respect to the mechanism, Claesson-Welsh et al 78 demonstrated that angiostatin has no effect on growth factor–induced signal transduction but leads to an arginine-glycine-aspartic acid (RGD)-independent activation of focal adhesion kinase. Furthermore, Gupta et al 79 have shown that angiostatin-induced EC apoptosis is associated with ceramide generation and RhoA activation. Interestingly, the antioxidantN-acetylcysteine inhibited the cytotoxic effects of angiostatin. 79 Finally, angiostatin can bind and block an a/b ATP-synthase on the surface of ECs, thereby inhibiting proliferation. 81,82 It is not known at this time whether this inhibitory effect on the ATP-synthase activity of angiostatin is involved in the induction of EC apoptosis.

Endostatin

Endostatin is a 20-kDa C-terminal fragment of collagen XVIII, which is produced by hemangioendothelioma. Endostatin is, like angiostatin, a potent inhibitor of in vivo tumor angiogenesis. 83 Endostatin can be generated by proteolytic processing of collagen XVIII performed by cathepsin L 84 or by a protease with elastase-like activity. 85 The major antiangiogenic effect of endostatin seems to be mediated by inhibition of EC migration. 86 Endostatin inhibits VEGF-induced EC migration by inducing eNOS dephosphorylation on Ser 1177 without affecting Akt activity. 87 Aside from the antimigratory effect, endostatin has been demonstrated to induce EC apoptosis. 88,89 Indeed, endostatin stimulation of ECs leads to marked reduction of Bcl-2 and Bcl-XL antiapoptotic proteins without affecting the level of the proapoptotic Bax protein. 88 Furthermore, the Shb adaptor protein has been suggested to be involved in the mediation of the apoptotic signaling of endostatin. 89 Rehn et al 90 demonstrated that soluble endostatin is capable of binding to αν- and α5-integrins, thereby inhibiting the integrin functions, such as EC migration. It is conceivable that such an interaction with integrins may affect EC survival.

Thrombospondin-1

Thrombospondin-1 (TSP-1) is a large multi-domain glycoprotein that has been shown to inhibit angiogenesis. 91 TSP-1 exerts its antiangiogenic activity via binding to the CD36 receptor by triggering an apoptotic signaling pathway. 92 Binding of TSP-1 to CD36 receptor leads to the recruitment of the Src-related kinase, p59-fyn, and to activation of p38 MAPK. The activation of the p38 MAPK was shown to be p59-fyn–dependent and to require a caspase-3–like proteolytic activity. Furthermore, activated p38 MAPK led to the activation of caspase-3 and to apoptosis. 92 Interestingly, the apoptotic effect of TSP-1 was restricted to ECs activated to take part in the angiogenic process and not in quiescent vessels. 92

Conclusion

Angiogenesis is dependent strongly on the suppression of EC apoptosis. Many of the proangiogenic growth factors promote the survival of ECs. Both angiogenesis and EC survival also are dependent on the attachment of ECs to the extracellular matrix and to cell-cell contacts. Inhibition of growth factor signaling or adhesion-dependent signaling can induce apoptosis directly and concomitant angiogenesis inhibition. Moreover, a common property of many angiogenic inhibitors is the induction of EC apoptosis. Therefore, the events that induce survival or apoptosis of ECs affect angiogenesis. It is conceivable that ECs integrate exogenous angiogenic and antiangiogenic stimuli and transform them intracellularly into conflicting survival and apoptotic signals. The prevailing signals may determine the fate of the ECs and, subsequently, the fate of the growing vessel. Elucidation of the molecular mechanisms that are involved in EC apoptosis and survival may lead to the development of new therapeutic approaches to enhance angiogenesis in the case of tissue ischemia (eg, revascularization of ischemic tissue) or to inhibit angiogenesis in the case of neovascularization-dependent disease (eg, tumor, diabetic retinopathy).

Received January 7, 2002 revision accepted February 27, 2002.

This work was funded by grants from the Deutsche Forschungsgemeinschaft (SFB 553, B6). We would like to apologize for our failure to cite many of the important and relevant studies in this field because of space limitations.


Chapter Seventeen - Exercise, Autophagy, and Apoptosis

Exercise is a form of physiological stress which is known to induce an adaptational response.

It is proposed that both apoptosis and autophagy are processes which are necessary for adaptation to exercise. Apoptosis and autophagy are induced during exercise to limit tissue damage, restore tissue integrity, terminate inflammatory responses, or induce direct signals for adaptation. Apoptosis is induced by specific mediators like reactive oxygen species, cytokines, and hormones. Autophagic pathways are activated by altered proteins/organelles with the aim to conserve and recycle the cellular resources. In this case, the cell is flooded with damaged molecules, the repairing mechanisms are overtaxed, and apoptosis is induced. In conclusion, autophagy seems to be necessary for adaptation by providing locally the conditions for muscle plasticity and apoptosis systemically by mobilizing progenitor cells.


Damage-Induced Apoptosis

Cytotoxic agents can induce apoptosis in many tissues. For example, low and high linear energy transfer ionizing radiation causes a dose-dependent increase in apoptosis in the small intestinal crypt within three to six hours of exposure [ 7 , 26 ]. Radiation-induced apoptosis occurs predominantly within the stem cell region—again indicating the specific sensitivity of cells at the stem cell position to apoptosis. Indeed, doses as low as 1-5 cGy (roughly equivalent to just one DNA-damaging event per cell) can induce stem cell apoptosis [ 7 ]. As the dose increases, however, more cells die, up to a dose of about 1 Gy in the small intestine where about six cells per crypt are killed. These highly sensitive cells do not appear capable of repair, as evidenced by the lack of a dose rate effect [ 26 ]. Higher doses do not induce more cells to enter apoptosis even though they are heavily damaged. Many of the damaged cells appear to prematurely differentiate and emigrate onto the villus [ 27 ]. A more extensive investigation of this phenomenon carried out by Ijiri and Potten [ 28 , 29 ] involved 18 different cytotoxic agents (later supplemented by four mutagens [ 30 , 31 ]) and examined the resultant apoptosis at each crypt position. It was found that each agent tended to target a specific crypt position or region but when examined collectively, the study showed that apoptosis could be induced throughout the crypt [ 28 , 29 ]. Further data supporting the hypothesis that all the epithelial cells are capable of apoptosis come from crypts isolated and placed in vitro which undergo apoptosis throughout the structure [ 32 ], and the fact that villus cells can be induced to apoptose by bacterial toxins [ 33 ] or by serial elution [ 34 ]. Similar interesting data have been produced in lymphocytes lacking p53 where radiation will not induce apoptosis, whereas other cytotoxics are potent apoptosis inducers [ 35 , 36 ]. These findings support the hypothesis that normally it is the in vivo ability to suppress apoptosis that is important, and distinguishes the survival ability of the different epithelial populations. This may be due to selective gene expression and also changes in the growth signals received by the cells.

In the large intestine differences are again observed when damage-induced apoptosis is considered. The apoptosis occurs at lower levels when specific low doses are studied it is not specifically located at the stem cell position at the crypt base, and the “plateau” in apoptotic yield seen at 1 Gy in the small bowel occurs at 6-8 Gy in the mid-colon.


Footnotes

Published by the Royal Society under the terms of the Creative Commons Attribution License http://creativecommons.org/licenses/by/4.0/, which permits unrestricted use, provided the original author and source are credited.

References

Bosch M, Serras F, Martin-Blanco E, Baguna J

. 2005 JNK signaling pathway required for wound healing in regenerating Drosophila wing imaginal discs . Dev. Biol. 280, 73-86. (doi:10.1016/j.ydbio.2005.01.002) Crossref, PubMed, ISI, Google Scholar

. 2004 Regulatory roles of JNK in programmed cell death . J. Biochem. 136, 1-6. (doi:10.1093/jb/mvh098) Crossref, PubMed, ISI, Google Scholar

2000 Requirement of JNK for stress-induced activation of the cytochrome c-mediated death pathway . Science 288, 870-874. (doi:10.1126/science.288.5467.870) Crossref, PubMed, ISI, Google Scholar

Sabapathy K, Hochedlinger K, Nam SY, Bauer A, Karin M, Wagner EF

. 2004 Distinct roles for JNK1 and JNK2 in regulating JNK activity and c-Jun-dependent cell proliferation . Mol. Cell. 15, 713-725. (doi:10.1016/j.molcel.2004.08.028) Crossref, PubMed, ISI, Google Scholar

. 2004 The control of cell motility and epithelial morphogenesis by Jun kinases . Trends Cell Biol. 14, 94-101. (doi:10.1016/j.tcb.2003.12.005) Crossref, PubMed, ISI, Google Scholar

Tejada-Romero B, Carter JM, Mihaylova Y, Neumann B, Aboobaker AA

. 2015 JNK signalling is necessary for a Wnt- and stem cell-dependent regeneration programme . Development 142, 2413-2424. (doi:10.1242/dev.115139) Crossref, PubMed, ISI, Google Scholar

Perez-Garijo A, Shlevkov E, Morata G

. 2009 The role of Dpp and Wg in compensatory proliferation and in the formation of hyperplastic overgrowths caused by apoptotic cells in the Drosophila wing disc . Development 136, 1169-1177. (doi:10.1242/dev.034017) Crossref, PubMed, ISI, Google Scholar

. 2017 JNK at the crossroad of obesity, insulin resistance, and cell stress response . Mol. Metab. 6, 174-184. (doi:10.1016/j.molmet.2016.12.001) Crossref, PubMed, ISI, Google Scholar

. 2006 Uses for JNK: the many and varied substrates of the c-Jun N-terminal kinases . Microbiol. Mol. Biol. Rev. 70, 1061-1095. (doi:10.1128/MMBR.00025-06) Crossref, PubMed, ISI, Google Scholar

. 2000 Signal transduction by the JNK group of MAP kinases . Cell 103, 239-252. (doi:10.1016/S0092-8674(00)00116-1) Crossref, PubMed, ISI, Google Scholar

Derijard B, Hibi M, Wu IH, Barrett T, Su B, Deng T, Karin M, Davis RJ

. 1994 JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain . Cell 76, 1025-1037. (doi:10.1016/0092-8674(94)90380-8) Crossref, PubMed, ISI, Google Scholar

Kallunki T, Su B, Tsigelny I, Sluss HK, Derijard B, Moore G, Davis R, Karin M.

1994 JNK2 contains a specificity-determining region responsible for efficient c-Jun binding and phosphorylation . Genes Dev. 8, 2996-3007. (doi:10.1101/gad.8.24.2996) Crossref, PubMed, ISI, Google Scholar

Gupta S, Barrett T, Whitmarsh AJ, Cavanagh J, Sluss HK, Derijard B, Davis RJ

. 1996 Selective interaction of JNK protein kinase isoforms with transcription factors . EMBO J. 15, 2760-2770. (doi:10.1002/j.1460-2075.1996.tb00636.x) Crossref, PubMed, ISI, Google Scholar

Adler V, Schaffer A, Kim J, Dolan L, Ronai Z

. 1995 UV irradiation and heat shock mediate JNK activation via alternate pathways . J. Biol. Chem. 270, 26 071-26 077. (doi:10.1074/jbc.270.44.26071) Crossref, ISI, Google Scholar

. 2014 The role of MAPK signalling pathways in the response to endoplasmic reticulum stress . Biochim Biophys. Acta 1843, 2150-2163. (doi:10.1016/j.bbamcr.2014.01.009) Crossref, PubMed, ISI, Google Scholar

. 2013 Drosophila at the intersection of infection, inflammation, and cancer . Front Cell Infect. Microbiol. 3, 130. (doi:10.3389/fcimb.2013.00103) Crossref, ISI, Google Scholar

. 2013 The 2 faces of JNK signaling in cancer . Genes Cancer. 4, 397-400. (doi:10.1177/1947601913486349) Crossref, PubMed, Google Scholar

. 2003 Role of JNK in tumor development . Cell Cycle 2, 199-201. PubMed, ISI, Google Scholar

. 2009 Correcting developmental errors by apoptosis: lessons from Drosophila JNK signaling . Apoptosis 14, 1021-1028. (doi:10.1007/s10495-009-0361-7) Crossref, PubMed, ISI, Google Scholar

. 1995 Noselli S. hemipterous encodes a novel Drosophila MAP kinase kinase, required for epithelial cell sheet movement . Cell 83, 451-461. (doi:10.1016/0092-8674(95)90123-X) Crossref, PubMed, ISI, Google Scholar

Riesgo-Escovar JR, Jenni M, Fritz A, Hafen E

. 1996 The Drosophila Jun-N-terminal kinase is required for cell morphogenesis but not for DJun-dependent cell fate specification in the eye . Genes Dev. 10, 2759-2768. (doi:10.1101/gad.10.21.2759) Crossref, PubMed, ISI, Google Scholar

. 1999 Thorax closure in Drosophila: involvement of Fos and the JNK pathway . Development 126, 3947-3956. PubMed, ISI, Google Scholar

Igaki T, Pagliarini RA, Xu T

. 2006 Loss of cell polarity drives tumor growth and invasion through JNK activation in Drosophila . Curr. Biol. 16, 1139-1146. (doi:10.1016/j.cub.2006.04.042) Crossref, PubMed, ISI, Google Scholar

Menendez J, Perez-Garijo A, Calleja M, Morata G

. 2010 A tumor-suppressing mechanism in Drosophila involving cell competition and the Hippo pathway . Proc. Natl Acad. Sci. USA 107, 14 651-14 656. (doi:10.1073/pnas.1009376107) Crossref, ISI, Google Scholar

Pinal N, Martin M, Medina I, Morata G

. 2018 Short-term activation of the Jun N-terminal kinase pathway in apoptosis-deficient cells of Drosophila induces tumorigenesis . Nat. Commun. 9, 1541. (doi:10.1038/s41467-018-04000-6) Crossref, PubMed, ISI, Google Scholar

Martin R, Pinal N, Morata G

. 2017 Distinct regenerative potential of trunk and appendages of Drosophila mediated by JNK signalling . Development 144, 3946-3956. (doi:10.1242/dev.155507) Crossref, PubMed, ISI, Google Scholar

Khan SJ, Abidi SNF, Skinner A, Tian Y, Smith-Bolton RK

. 2017 The Drosophila Duox maturation factor is a key component of a positive feedback loop that sustains regeneration signaling . PLoS Genet. 13, e1006937. (doi:10.1371/journal.pgen.1006937) Crossref, PubMed, ISI, Google Scholar

Clavier A, Rincheval-Arnold A, Colin J, Mignotte B, Guenal I

. 2016 Apoptosis in Drosophila: which role for mitochondria? Apoptosis 21, 239-251. (doi:10.1007/s10495-015-1209-y) Crossref, PubMed, ISI, Google Scholar

Denton D, Aung-Htut MT, Kumar S

. 2013 Developmentally programmed cell death in Drosophila . Biochim. Biophys. Acta 1833, 3499-3506. (doi:10.1016/j.bbamcr.2013.06.014) Crossref, PubMed, ISI, Google Scholar

Savitskaya MA, Onishchenko GE

. 2015 Mechanisms of apoptosis . Biochemistry (Mosc) 80, 1393-1405. (doi:10.1134/S0006297915110012) Crossref, PubMed, ISI, Google Scholar

. 2011 Programmed cell death in animal development and disease . Cell 147, 742-758. (doi:10.1016/j.cell.2011.10.033) Crossref, PubMed, ISI, Google Scholar

Manjon C, Sanchez-Herrero E, Suzanne M

. 2007 Sharp boundaries of Dpp signalling trigger local cell death required for Drosophila leg morphogenesis . Nat. Cell Biol. 9, 57-63. (doi:10.1038/ncb1518) Crossref, PubMed, ISI, Google Scholar

2000 The combined functions of proapoptotic Bcl-2 family members bak and bax are essential for normal development of multiple tissues . Mol. Cell. 6, 1389-1399. (doi:10.1016/S1097-2765(00)00136-2) Crossref, PubMed, ISI, Google Scholar

Ishizuya-Oka A, Hasebe T, Shi YB

. 2010 Apoptosis in amphibian organs during metamorphosis . Apoptosis 15, 350-364. (doi:10.1007/s10495-009-0422-y) Crossref, PubMed, ISI, Google Scholar

. 2001 Cellular responses to DNA damage . Annu. Rev. Pharmacol. Toxicol. 41, 367-401. (doi:10.1146/annurev.pharmtox.41.1.367) Crossref, PubMed, ISI, Google Scholar

Perez-Garijo A, Martin FA, Morata G

. 2004 Caspase inhibition during apoptosis causes abnormal signalling and developmental aberrations in Drosophila . Development 131, 5591-5598. (doi:10.1242/dev.01432) Crossref, PubMed, ISI, Google Scholar

Wells BS, Yoshida E, Johnston LA

. 2006 Compensatory proliferation in Drosophila imaginal discs requires Dronc-dependent p53 activity . Curr. Biol. 16, 1606-1615. (doi:10.1016/j.cub.2006.07.046) Crossref, PubMed, ISI, Google Scholar

. 2012 A dp53/JNK-dependant feedback amplification loop is essential for the apoptotic response to stress in Drosophila . Cell Death Differ. 19, 451-460. (doi:10.1038/cdd.2011.113) Crossref, PubMed, ISI, Google Scholar

. 2015 Reactive oxygen species in planarian regeneration: an upstream necessity for correct patterning and brain formation . Oxid. Med. Cell. Longev. 2015, 392476. (doi:10.1155/2015/392476) Crossref, PubMed, ISI, Google Scholar

Love NR, Chen Y, Ishibashi S, Kritsiligkou P, Lea R, Koh Y, Gallop JL, Dorey K, Amaya E.

2013 Amputation-induced reactive oxygen species are required for successful Xenopus tadpole tail regeneration . Nat. Cell Biol. 15, 222-228. (doi:10.1038/ncb2659) Crossref, PubMed, ISI, Google Scholar

Niethammer P, Grabher C, Look AT, Mitchison TJ

. 2009 A tissue-scale gradient of hydrogen peroxide mediates rapid wound detection in zebrafish . Nature 459, 996-999. (doi:10.1038/nature08119) Crossref, PubMed, ISI, Google Scholar

Brock AR, Seto M, Smith-Bolton RK

. 2017 Cap-n-collar promotes tissue regeneration by regulating ROS and JNK signaling in the Drosophila melanogaster wing imaginal disc . Genetics 206, 1505-1520. (doi:10.1534/genetics.116.196832) Crossref, PubMed, ISI, Google Scholar

2015 ROS-induced JNK and p38 signaling is required for unpaired cytokine activation during Drosophila regeneration . PLoS Genet. 11, e1005595. (doi:10.1371/journal.pgen.1005595) Crossref, PubMed, ISI, Google Scholar

Ryoo HD, Gorenc T, Steller H

. 2004 Apoptotic cells can induce compensatory cell proliferation through the JNK and the Wingless signaling pathways . Dev. Cell. 7, 491-501. (doi:10.1016/j.devcel.2004.08.019) Crossref, PubMed, ISI, Google Scholar

. 2012 The cell biology of regeneration . J. Cell Biol. 196, 553-562. (doi:10.1083/jcb.201105099) Crossref, PubMed, ISI, Google Scholar

Gutierrez-Avino FJ, Ferres-Marco D, Dominguez M

. 2009 The position and function of the Notch-mediated eye growth organizer: the roles of JAK/STAT and four-jointed . EMBO Rep. 10, 1051-1058. (doi:10.1038/embor.2009.140) Crossref, PubMed, ISI, Google Scholar

. 2010 Paracrine unpaired signaling through the JAK/STAT pathway controls self-renewal and lineage differentiation of Drosophila intestinal stem cells . J. Mol. Cell Biol. 2, 37-49. (doi:10.1093/jmcb/mjp028) Crossref, PubMed, ISI, Google Scholar

. 2010 Warts and Yorkie mediate intestinal regeneration by influencing stem cell proliferation . Curr. Biol. 20, 1580-1587. (doi:10.1016/j.cub.2010.07.041) Crossref, PubMed, ISI, Google Scholar

. 2011 Regulation of Hippo signaling by Jun kinase signaling during compensatory cell proliferation and regeneration, and in neoplastic tumors . Dev. Biol. 350, 139-151. (doi:10.1016/j.ydbio.2010.11.036) Crossref, PubMed, ISI, Google Scholar

. 1975 Minutes: mutants of drosophila autonomously affecting cell division rate . Dev. Biol. 42, 211-221. (doi:10.1016/0012-1606(75)90330-9) Crossref, PubMed, ISI, Google Scholar

. 1998 The minute genes in Drosophila and their molecular functions . Adv. Genet. 38, 69-134. (doi:10.1016/S0065-2660(08)60142-X) Crossref, PubMed, ISI, Google Scholar

. 1979 Parameters of cell competition in the compartments of the wing disc of Drosophila . Dev. Biol. 69, 182-193. (doi:10.1016/0012-1606(79)90284-7) Crossref, PubMed, ISI, Google Scholar

. 1981 Differential mitotic rates and patterns of growth in compartments in the Drosophila wing . Dev. Biol. 85, 299-308. (doi:10.1016/0012-1606(81)90261-X) Crossref, PubMed, ISI, Google Scholar

Adachi-Yamada T, O'Connor MB

. 2002 Morphogenetic apoptosis: a mechanism for correcting discontinuities in morphogen gradients . Dev. Biol. 251, 74-90. (doi:10.1006/dbio.2002.0821) Crossref, PubMed, ISI, Google Scholar

Bohni R, Riesgo-Escovar J, Oldham S, Brogiolo W, Stocker H, Andruss BF, Beckingham K, Hafen E

. 1999 Autonomous control of cell and organ size by CHICO, a Drosophila homolog of vertebrate IRS1-4 . Cell 97, 865-875. (doi:10.1016/S0092-8674(00)80799-0) Crossref, PubMed, ISI, Google Scholar

Johnston LA, Prober DA, Edgar BA, Eisenman RN, Gallant P

. 1999 Drosophila myc regulates cellular growth during development . Cell 98, 779-790. (doi:10.1016/S0092-8674(00)81512-3) Crossref, PubMed, ISI, Google Scholar

. 2003 Richardson HE. scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila . EMBO J. 22, 5769-5779. (doi:10.1093/emboj/cdg548) Crossref, PubMed, ISI, Google Scholar

Ballesteros-Arias L, Saavedra V, Morata G

. 2014 Cell competition may function either as tumour-suppressing or as tumour-stimulating factor in Drosophila . Oncogene 33, 4377-4384. (doi:10.1038/onc.2013.407) Crossref, PubMed, ISI, Google Scholar

Morata G, Ballesteros-Arias L

. 2015 Cell competition, apoptosis and tumour development . Int. J. Dev. Biol. 59, 79-86. (doi:10.1387/ijdb.150081gm) Crossref, PubMed, ISI, Google Scholar

Moreno E, Basler K, Morata G

. 2002 Cells compete for decapentaplegic survival factor to prevent apoptosis in Drosophila wing development . Nature 416, 755-759. (doi:10.1038/416755a) Crossref, PubMed, ISI, Google Scholar

. 2006 Regulation of imaginal disc growth by tumor-suppressor genes in Drosophila . Annu. Rev. Genet. 40, 335-361. (doi:10.1146/annurev.genet.39.073003.100738) Crossref, PubMed, ISI, Google Scholar

Chen CL, Schroeder MC, Kango-Singh M, Tao C, Halder G

. 2012 Tumor suppression by cell competition through regulation of the Hippo pathway . Proc. Natl Acad. Sci. USA 109, 484-489. (doi:10.1073/pnas.1113882109) Crossref, PubMed, ISI, Google Scholar

Igaki T, Pastor-Pareja JC, Aonuma H, Miura M, Xu T

. 2009 Intrinsic tumor suppression and epithelial maintenance by endocytic activation of Eiger/TNF signaling in Drosophila . Dev. Cell. 16, 458-465. (doi:10.1016/j.devcel.2009.01.002) Crossref, PubMed, ISI, Google Scholar

Alpar L, Bergantinos C, Johnston LA

. 2018 Spatially restricted regulation of Spatzle/Toll signaling during cell competition . Dev. Cell. 46, 706-719.e5. (doi:10.1016/j.devcel.2018.08.001) Crossref, PubMed, ISI, Google Scholar

Yamamoto M, Ohsawa S, Kunimasa K, Igaki T

. 2017 The ligand Sas and its receptor PTP10D drive tumour-suppressive cell competition . Nature 542, 246-250. (doi:10.1038/nature21033) Crossref, PubMed, ISI, Google Scholar

Chang Q, Zhang Y, Beezhold KJ, Bhatia D, Zhao H, Chen J, Castranova V, Shi X, Chen F.

2009 Sustained JNK1 activation is associated with altered histone H3 methylations in human liver cancer . J Hepatol. 50, 323-333. (doi:10.1016/j.jhep.2008.07.037) Crossref, PubMed, ISI, Google Scholar

Sakurai T, Maeda S, Chang L, Karin M

. 2006 Loss of hepatic NF-κ B activity enhances chemical hepatocarcinogenesis through sustained c-Jun N-terminal kinase 1 activation . Proc. Natl Acad. Sci. USA 103, 10 544-10 551. (doi:10.1073/pnas.0603499103) Crossref, ISI, Google Scholar

Wu M, Pastor-Pareja JC, Xu T

. 2010 Interaction between Ras(V12) and scribbled clones induces tumour growth and invasion . Nature 463, 545-548. (doi:10.1038/nature08702) Crossref, PubMed, ISI, Google Scholar

Urban S, Brown G, Freeman M

. 2004 EGF receptor signalling protects smooth-cuticle cells from apoptosis during Drosophila ventral epidermis development . Development 131, 1835-1845. (doi:10.1242/dev.01058) Crossref, PubMed, ISI, Google Scholar

2011 Caspase 3-mediated stimulation of tumor cell repopulation during cancer radiotherapy . Nat. Med. 17, 860-866. (doi:10.1038/nm.2385) Crossref, PubMed, ISI, Google Scholar

Gregory CD, Ford CA, Voss JJ

. 2016 Microenvironmental effects of cell death in malignant disease . Adv. Exp. Med. Biol. 930, 51-88. (doi:10.1007/978-3-319-39406-0_3) Crossref, PubMed, ISI, Google Scholar

2018 HMGB1 released by irradiated tumor cells promotes living tumor cell proliferation via paracrine effect . Cell Death Dis. 9, 648. (doi:10.1038/s41419-018-0626-6) Crossref, PubMed, ISI, Google Scholar

Zimmerman MA, Huang Q, Li F, Liu X, Li CY

. 2013 Cell death-stimulated cell proliferation: a tissue regeneration mechanism usurped by tumors during radiotherapy . Semin. Radiat. Oncol. 23, 288-295. (doi:10.1016/j.semradonc.2013.05.003) Crossref, PubMed, ISI, Google Scholar

. 2007 The c-jun kinase/stress-activated pathway: regulation, function and role in human disease . Biochim. Biophys. Acta 1773, 1341-1348. (doi:10.1016/j.bbamcr.2006.12.009) Crossref, PubMed, ISI, Google Scholar

Der CJ, Krontiris TG, Cooper GM

. 1982 Transforming genes of human bladder and lung carcinoma cell lines are homologous to the ras genes of Harvey and Kirsten sarcoma viruses . Proc. Natl Acad. Sci. USA 79, 3637-3640. (doi:10.1073/pnas.79.11.3637) Crossref, PubMed, ISI, Google Scholar

Parada LF, Tabin CJ, Shih C, Weinberg RA

. 1982 Human EJ bladder carcinoma oncogene is homologue of Harvey sarcoma virus ras gene . Nature 297, 474-478. (doi:10.1038/297474a0) Crossref, PubMed, ISI, Google Scholar

Santos E, Tronick SR, Aaronson SA, Pulciani S, Barbacid M

. 1982 T24 human bladder carcinoma oncogene is an activated form of the normal human homologue of BALB- and Harvey-MSV transforming genes . Nature 298, 343-347. (doi:10.1038/298343a0) Crossref, PubMed, ISI, Google Scholar

Stephen AG, Esposito D, Bagni RK, McCormick F

. 2014 Dragging ras back in the ring . Cancer Cell. 25, 272-281. (doi:10.1016/j.ccr.2014.02.017) Crossref, PubMed, ISI, Google Scholar

Bergmann A, Agapite J, McCall K, Steller H

. 1998 The Drosophila gene hid is a direct molecular target of Ras-dependent survival signaling . Cell 95, 331-341. (doi:10.1016/S0092-8674(00)81765-1) Crossref, PubMed, ISI, Google Scholar

. 1996 Two distinct roles for Ras in a developmentally regulated cell migration . Development 122, 409-418. PubMed, ISI, Google Scholar

. 2003 The dark side of Ras: regulation of apoptosis . Oncogene 22, 8999-9006. (doi:10.1038/sj.onc.1207111) Crossref, PubMed, ISI, Google Scholar

Behrens A, Jochum W, Sibilia M, Wagner EF

. 2000 Oncogenic transformation by ras and fos is mediated by c-Jun N-terminal phosphorylation . Oncogene 19, 2657-2663. (doi:10.1038/sj.onc.1203603) Crossref, PubMed, ISI, Google Scholar

Almuedo-Castillo M, Crespo-Yanez X, Seebeck F, Bartscherer K, Salo E, Adell T

. 2014 JNK controls the onset of mitosis in planarian stem cells and triggers apoptotic cell death required for regeneration and remodeling . PLoS Genet. 10, e1004400. (doi:10.1371/journal.pgen.1004400) Crossref, PubMed, ISI, Google Scholar

Bergantinos C, Corominas M, Serras F

. 2010 Cell death-induced regeneration in wing imaginal discs requires JNK signalling . Development 137, 1169-1179. (doi:10.1242/dev.045559) Crossref, PubMed, ISI, Google Scholar

Gauron C, Rampon C, Bouzaffour M, Ipendey E, Teillon J, Volovitch M, Vriz S

. 2013 Sustained production of ROS triggers compensatory proliferation and is required for regeneration to proceed . Sci. Rep. 3, 2084. (doi:10.1038/srep02084) Crossref, PubMed, ISI, Google Scholar

Morata G, Shlevkov E, Perez-Garijo A

. 2011 Mitogenic signaling from apoptotic cells in Drosophila . Dev. Growth Differ. 53, 168-176. (doi:10.1111/j.1440-169X.2010.01225.x) Crossref, PubMed, ISI, Google Scholar

Katsuyama T, Comoglio F, Seimiya M, Cabuy E, Paro R

. 2015 During Drosophila disc regeneration. JAK/STAT coordinates cell proliferation with Dil 8.-mediated developmental delay . Proc. Natl Acad. Sci. USA 112, E2327-E2336. (doi:10.1073/pnas.1423074112) Crossref, PubMed, ISI, Google Scholar

Jiang H, Patel PH, Kohlmaier A, Grenley MO, McEwen DG, Edgar BA

. 2009 Cytokine/Jak/Stat signaling mediates regeneration and homeostasis in the Drosophila midgut . Cell 137, 1343-1355. (doi:10.1016/j.cell.2009.05.014) Crossref, PubMed, ISI, Google Scholar

Mattila J, Omelyanchuk L, Nokkala S

. 2004 Dynamics of decapentaplegic expression during regeneration of the Drosophila melanogaster wing imaginal disc . Int. J. Dev. Biol. 48, 343-347. (doi:10.1387/ijdb.041847jm) Crossref, PubMed, ISI, Google Scholar

Smith-Bolton RK, Worley MI, Kanda H, Hariharan IK

. 2009 Regenerative growth in Drosophila imaginal discs is regulated by Wingless and Myc . Dev. Cell. 16, 797-809. (doi:10.1016/j.devcel.2009.04.015) Crossref, PubMed, ISI, Google Scholar

Harris RE, Setiawan L, Saul J, Hariharan IK

. 2016 Localized epigenetic silencing of a damage-activated WNT enhancer limits regeneration in mature Drosophila imaginal discs . Elife 5, e11588. (doi:10.7554/eLife.11588) Crossref, PubMed, ISI, Google Scholar

La Fortezza M, Schenk M, Cosolo A, Kolybaba A, Grass I, Classen AK

. 2016 JAK/STAT signalling mediates cell survival in response to tissue stress . Development 143, 2907-2919. (doi:10.1242/dev.132340) Crossref, PubMed, ISI, Google Scholar

Gurley KA, Rink JC, Sanchez Alvarado A

. 2008 Beta-catenin defines head versus tail identity during planarian regeneration and homeostasis . Science 319, 323-327. (doi:10.1126/science.1150029) Crossref, PubMed, ISI, Google Scholar

2009 Multiple Wnts are involved in Hydra organizer formation and regeneration . Dev. Biol. 330, 186-199. (doi:10.1016/j.ydbio.2009.02.004) Crossref, PubMed, ISI, Google Scholar

Kawakami Y, Rodriguez Esteban C, Raya M, Kawakami H, Marti M, Dubova I, Belmonte JC

. 2006 Wnt/beta-catenin signaling regulates vertebrate limb regeneration . Genes Dev. 20, 3232-3237. (doi:10.1101/gad.1475106) Crossref, PubMed, ISI, Google Scholar

Stoick-Cooper CL, Weidinger G, Riehle KJ, Hubbert C, Major MB, Fausto N, Moon RT

. 2007 Distinct Wnt signaling pathways have opposing roles in appendage regeneration . Development 134, 479-489. (doi:10.1242/dev.001123) Crossref, PubMed, ISI, Google Scholar

Yokoyama H, Ogino H, Stoick-Cooper CL, Grainger RM, Moon RT

. 2007 Wnt/beta-catenin signaling has an essential role in the initiation of limb regeneration . Dev. Biol. 306, 170-178. (doi:10.1016/j.ydbio.2007.03.014) Crossref, PubMed, ISI, Google Scholar

. 2008 Requirement for Wnt and FGF signaling in Xenopus tadpole tail regeneration . Dev. Biol. 316, 323-335. (doi:10.1016/j.ydbio.2008.01.032) Crossref, PubMed, ISI, Google Scholar

Chera S, Ghila L, Dobretz K, Wenger Y, Bauer C, Buzgariu W, Martinou JC, Galliot B

. 2009 Apoptotic cells provide an unexpected source of Wnt3 signaling to drive hydra head regeneration . Dev. Cell 17, 279-289. (doi:10.1016/j.devcel.2009.07.014) Crossref, PubMed, ISI, Google Scholar

. 2008 Smed-betacatenin-1 is required for anteroposterior blastema polarity in planarian regeneration . Science 319, 327-330. (doi:10.1126/science.1149943) Crossref, PubMed, ISI, Google Scholar


References

Kerr, J. F., Wyllie, A. H. & Currie, A. R. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br. J. Cancer 4, 239–257 (1972).

Vogt, C. Untersuchungen über die Entwicklungsgeschichte der Geburtshelferkröte. (Alytes obstetricians) 130 (Jent und Gassman, 1842).

Glucksmann, A. Cell death in normal vertebrate ontogeny. Biol. Rev. 26, 59–86 (1951).

Saunders, J. W. Jr. Death in embryonic systems. Science 154, 604–612 (1966).

Lockshin, R. A. & Williams, C. M. Programmed cell death – 1. Cytology of degeneration in the intersegmental muscles of the pernyi silkmoth. J. Insect Physiol. 11, 123–133 (1965).

Kerr, J. F. A histochemical study of hypertrophy and ishaemic injury or rat liver with special reference to changes in lysosomes. J. Pathol. Bacteriol. 90, 419–435 (1965).

Wyllie, A. H. Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature 284, 555–560 (1980).

Wyllie, A. H., Kerr, J. F. & Currie, A. R. Cell death: the significance of apoptosis. Int. Rev. Cytol. 68, 251–306 (1980).

Enari, M. et al. A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature 391, 43–50 (1998).

Horvitz, H. R. Nobel lecture. Worms, life and death. Biosci. Rep. 5, 239–303 (2003).

Kerr, J. F., Winterford, C. M. & Harmon, B. V. Apoptosis. Its significance in cancer and cancer therapy. Cancer 73, 2013–2026 (1994).

Lowe, S. W. et al. P53-dependent apoptosis modulates the cytotoxicity of anticancer agents. Cell 74, 957–967 (1993).

McGahon, A. et al. BCR-ABL maintains resistance of chronic myelogenous leukemia cells to apoptotic cell death. Blood 83, 1179–1187 (1994).

Krammer, P. H. et al. CD95(APO-1/Fas)-mediated apoptosis in normal and malignant liver, colon, and hematopoietic cells. Adv. Cancer Res. 75, 251–273 (1998).

Tsujimoto, Y. et al. Cloning of the chromosome breakpoint of neoplastic B cells with the t(1418) chromosome translocation. Science 226, 1097–1099 (1984).

Tsujimoto, Y. & Croce, C. M. Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma. Proc. Natl Acad. Sci. USA 83, 5214–5218 (1986).

Cleary, M. L., Smith, S. D. & Sklar, J. Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(1418) translocation. Cell 47, 19–28 (1986).

Vaux, D. L. Early work on the function of Bcl-2, an interview with David Vaux. Cell Death Differ. 11, S28–S32 (2004).

Rowley, J. D. A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and giemsa staining. Nature 243, 290–293 (1973).

Vaux, D. L, Cory, S. & Adams, J. M. Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature 335, 440–442 (1988).

Tsujimoto, Y. Stress-resistance conferred by high level of bcl-2 alpha protein in human B lymphoblastoid cell. Oncogene 11, 1331–1336 (1989).

Williams, G. T. et al. Haemopoietic colony stimulating factors promote cell survival by suppressing apoptosis. Nature 343, 76–79 (1990).

Rodriguez-Tarduchy, G., Collins, M. & López-Rivas, A. Regulation of apoptosis in interleukin-3-dependent hemopoietic cells by interleukin-3 and calcium ionophores. EMBO J. 9, 2997–3002 (1990).

Crompton, T. IL3-dependent cells die by apoptosis on removal of their growth factor. Growth Factors 4, 109–116 (1991).

Reed, J. C. et al. Oncogenic potential of bcl-2 demonstrated by gene transfer. Nature 336, 259–261 (1988).

McDonnell, T. J. et al. bcl-2-immunoglobulin transgenic mice demonstrate extended B cell survival and follicular lymphoproliferation. Cell 57, 79–88 (1989).

Reed, J. C. et al. Antisense-mediated inhibition of BCL2 protooncogene expression and leukemic cell growth and survival: comparisons of phosphodiester and phosphorothioate oligodeoxynucleotides. Cancer Res. 50, 6565–6570 (1990).

Hockenbery, D. et al. Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature 348, 334–336 (1990).

Liu, X. et al. Induction of apoptotic program in cell-free extracts: requirement for dATP and cytochrome c. Cell 86, 147–157 (1996).

Yang, J. et al. Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked. Science 275, 1129–1132 (1997).

Creagh, E. M., Conroy, H. & Martin, S. J. Caspase-activation pathways in apoptosis and immunity. Immunol. Rev. 193, 10–21 (2003).

Kroemer, G., Galluzzi, L. & Brenner, C. Mitochondrial membrane permeabilization in cell death. Physiol. Rev. 87, 99–163 (2007).

Boise, L. H. et al. bcl-x, a bcl-2-related gene that functions as a dominant regulator of apoptotic cell death. Cell 74, 597–608 (1993).

Gibson, L. et al. bcl-w, a novel member of the bcl-2 family, promotes cell survival. Oncogene 13, 665–675 (1996 ).

Kozopas, K. M. et al. MCL1, a gene expressed in programmed myeloid cell differentiation, has sequence similarity to BCL2. Proc. Natl Acad. Sci. USA 90, 3516–3520 (1993).

Du, C., Fang, M., Li, Y., Li, L. & Wang, X. Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell 102, 33–42 (2000).

Verhagen, A. M. et al. Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102, 43–53 (2000).

Oltvai, Z. N., Milliman, C. L. & Korsmeyer, S. J. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74, 609–619 (1993).

Chittenden, T. et al. Induction of apoptosis by the Bcl-2 homologue Bak. Nature 374, 733–736 (1995).

O'Connor, L. et al. Bim: a novel member of the Bcl-2 family that promotes apoptosis. EMBO J. 17, 384–395 (1998).

Wang, K. et al. BID: a novel BH3 domain-only death agonist. Genes Dev. 10, 2859–2869 (1996).

Yang, E. et al. Bad, a heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax and promotes cell death. Cell 80, 285–291 (1995).

Yip, K. W. & Reed, J. C. Bcl-2 family proteins and cancer. Oncogene 27, 6398–6406 (2008).

Monni, O. et al. BCL2 over-expression associated with chromosomal amplification in diffuse large B-cell lymphoma. Blood 90, 1168–1174 (1997).

Ikegaki, N. et al. Expression of bcl-2 in small cell lung carcinoma cells. Cancer Res. 54, 6–8 (1994).

Hanada, M. et al. bcl-2 gene hypomethylation and high-level expression in B-cell chronic lymphocytic leukemia. Blood 82, 1820–1828 (1993).

Cimmino, A. et al. miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc. Natl Acad. Sci. USA 102, 13944–13949 (2005).

Miyashita, T. et al. Tumor suppressor p53 is a regulator of bcl-2 and bax gene expression in vitro and in vivo. Oncogene 6, 1799–1805 (1994).

Miyashita, T. & Reed, J. C. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80, 293–299 (1995).

Oda, E. et al. Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of p53-induced apoptosis. Science 288, 1053–1058 (2000).

Sax, J. K. et al. BID regulation by p53 contributes to chemosensitivity. Nature Cell Biol. 11, 842–849 (2002).

Yu, J., Zhang, L., Hwang, P. M., Kinzler, K. W. & Vogelstein, B. PUMA induces the rapid apoptosis of colorectal cancer cells. Mol. Cell 7, 673–682 (2001).

Nakano, K. & Vousden, K. H. PUMA, a novel proapoptotic gene, is induced by p53. Mol. Cell 7, 683–694 (2001).

Ranger, A. M. et al. Bad-deficient mice develop diffuse large B cell lymphoma. Proc. Natl Acad. Sci. USA 100, 9324–9329 (2003).

Zinkel, S. S. et al. A role for proapoptotic BID in the DNA-damage response. Cell 122, 579–591 (2005).

Bouillet, P. et al. Proapoptotic Bcl-2 relative Bim required for certain apoptotic responses, leukocyte homeostasis, and to preclude autoimmunity. Science 286, 1735–1738 (1999).

Gascoyne, R. D. et al. Prognostic significance of Bcl-2 protein expression and Bcl-2 gene rearrangement in diffuse aggressive non-Hodgkin's lymphoma. Blood 90, 244–251 (1997).

Gobe, G. E. et al. Apoptosis and expression of Bcl-2, Bcl-XL, and Bax in renal cell carcinomas. Cancer Invest. 20, 324–332 (2002).

Ayhan, A. et al. Loss of heterozygosity at the bcl-2 gene locus and expression of bcl-2 in human gastric and colorectal carcinomas. Jpn J. Cancer Res. 85, 584–591 (1994).

Castle, V. P. et al. Expression of the apoptosis-suppressing protein bcl-2, in neuroblastoma is associated with unfavorable histology and N-myc amplification. Am. J. Pathol. 143, 1543–1550 (1993).

Casado, S. et al. Predictive value of P53, BCL-2, and BAX in advanced head and neck carcinoma. Am. J. Clin. Oncol. 25, 588–590 (2002).

Gradilone, A. et al. Survivin, bcl-2, bax, and bcl-X gene expression in sentinel lymph nodes from melanoma patients. J. Clin. Oncol. 21, 306–312 (2003). .

Stavropoulos, N. E. et al. Prognostic significance of p53, bcl-2 and Ki-67 in high risk superficial bladder cancer. Anticancer Res. 22, 3759–3764 (2002).

Chang, J. et al. Survival of patients with metastatic breast carcinoma: importance of prognostic markers of the primary tumor. Cancer 97, 545–553 (2003).

Bargou, R. C. et al. Expression of the bcl-2 gene family in normal and malignant breast tissue: low bax-alpha expression in tumor cells correlates with resistance towards apoptosis. Int. J. Cancer. 60, 854–859 (1995).

Krajewski, S. et al. Reduced expression of proapoptotic gene BAX is associated with poor response rates to combination chemotherapy and shorter survival in women with metastatic breast adenocarcinoma. Cancer Res. 55, 4471–4478 (1995).

Sjöström, J. et al. A multivariate analysis of tumour biological factors predicting response to cytotoxic treatment in advanced breast cancer. Br. J. Cancer 78, 812–815 (1998).

Krajewski, S. et al. Prognostic significance of apoptosis regulators in breast cancer. Endocr. Relat. Cancer 6, 29–40 (1999).

Kymionis, G. D. et al. Can expression of apoptosis genes, bcl-2 and bax, predict survival and responsiveness to chemotherapy in node-negative breast cancer patients? J. Surg. Res. 99, 161–168 (2001).

Letai, A. G. Diagnosing and exploiting cancer's addiction to blocks in apoptosis. Nature Rev. Cancer 8, 121–132 (2008).

Sentman, C. L. et al. bcl-2 inhibits multiple forms of apoptosis but not negative selection in thymocytes. Cell 67, 879–888 (1991).

Webb, A. et al. BCL-2 antisense therapy in patients with non-Hodgkin lymphoma. Lancet 349, 1137–1141 (1997).

Lessene, G., Czabotar, P. E. & Colman, P. M. BCL-2 family antagonists for cancer therapy. Nature Rev. Drug Discov. 7, 989–1000 (2008).

Askew, D. S., Ashmun, R. A., Simmons, B. C. & Cleveland, J. L. Constitutive c-myc expression in an IL-3-dependent myeloid cell line suppresses cell cycle arrest and accelerates apoptosis. Oncogene 19, 15–22 (1991).

Shi, Y. et al. Role for c-myc in activation-induced apoptotic cell death in T cell hybridomas. Science 257, 212–214 (1992).

Evan, G. I. et al. Induction of apoptosis in fibroblasts by c-myc protein. Cell 69, 119–128 (1992).

Strasser, A., Harris, A. W, Bath, M. L. & Cory, S. Novel primitive lymphoid tumours induced in transgenic mice by cooperation between myc and bcl-2. Nature 348, 331–333 (1990).

Soucie, E. L. et al. Myc potentiates apoptosis by stimulating Bax activity at the mitochondria. Mol. Cell. Biol. 21, 4725–4736 (2001).

de Alborán, I. M. Baena, E. & Martinez- A. C. c-Myc-deficient B lymphocytes are resistant to spontaneous and induced cell death. Cell Death Differ. 11, 61–68 (2004).

Eischen, C. M. et al. Bcl-2 is an apoptotic target suppressed by both c-Myc and E2F-1. Oncogene 20, 6983–6993 (2001).

Maclean, K. H. et al. c-Myc augments gamma irradiation-induced apoptosis by suppressing Bcl-XL. Mol. Cell. Biol. 23, 7256–7270 (2003).

Dansen, T. B. et al. Specific requirement for Bax, not Bak, in Myc-induced apoptosis and tumor suppression in vivo. J. Biol. Chem. 281, 10890–10895 (2006).

Felsher, D. W. & Bishop, J. M. Reversible tumorigenesis by MYC in hematopoietic lineages. Mol. Cell 4, 199–207 (1999).

Pelengaris, S. et al. Reversible activation of c-Myc in skin: induction of a complex neoplastic phenotype by a single oncogenic lesion. Mol. Cell 3, 565–577 (1999).

Yonish-Rouach, E. et al. Wild-type p53 induces apoptosis of myeloid leukaemic cells that is inhibited by interleukin-6. Nature 352, 345–347 (1991).

Zhan, Q. et al. Induction of bax by genotoxic stress in human cells correlates with normal p53 status and apoptosis. Oncogene 9, 3743–3751 (1994).

Lapenko, O. & Prives, C. Transcriptional regulation by p53: one protein, many possibilities. Cell Death Differ. 13, 951–961 (2006).

Trauth, B. C. et al. Monoclonal antibody-mediated tumor regression by induction of apoptosis. Science 245, 301–305 (1989).

Yonehara, S., Ishii, A. & Yonehara, M. A cell-killing monoclonal antibody (anti-Fas) to a cell surface antigen co-downregulated with the receptor of tumor necrosis factor. J. Exp. Med. 169, 1747–1756 (1989).

Itoh, N. et al. The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis. Cell 66, 233–243 (1991).

Suda, T., Takahashi, T., Golstein, P. & Nagata, S. Molecular cloning and expression of the Fas ligand, a novel member of the tumor necrosis factor family. Cell 75, 1169–1178 (1993).

Ogasawara, J. et al. Lethal effect of the anti-Fas antibody in mice. Nature 364, 806–809 (1993).

Johnstone, R. W., Frew, A. J. & Smyth, M. J. The TRAIL apoptotic pathway in cancer onset, progression and therapy. Nature Rev. Cancer 8, 782–798 (2008).

Pitti, R. M. et al. Induction of apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor cytokine family. J. Biol. Chem. 271, 12687–12690 (1996).

Wiley, S. R. et al. Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity 3, 673–682 (1995).

Friesen, C., Herr, I., Krammer, P. H. & Debatin, K. M. Involvement of the CD95 (APO-1/FAS) receptor/ligand system in drug-induced apoptosis in leukemia cells. Nature Med. 2, 574–577 (1996).

Fulda, S., Susin, S. A., Kroemer, G. & Debatin, K. M. Molecular ordering of apoptosis induced by anticancer drugs in neuroblastoma cells. Cancer Res. 58, 4453–4460 (1998).

Müller, M. et al. Drug-induced apoptosis in hepatoma cells is mediated by the CD95 (APO-1/Fas) receptor/ligand system and involves activation of wild-type p53. J. Clin. Invest. 99, 403–413 (1997). .

Müller, M. et al. p53 activates the CD95 (APO-1/Fas) gene in response to DNA damage by anticancer drugs. J. Exp. Med. 188, 2033–2045 (1998).

Bellgrau, D. et al. A role for CD95 ligand in preventing graft rejection. Nature 377, 630–632 (1995).

Griffith, T. S. et al. Fas ligand-induced apoptosis as a mechanism of immune privilege. Science 270, 1189–1192 (1995).

Strand, S. et al. Lymphocyte apoptosis induced by CD95 (APO-1/Fas) ligand-expressing tumor cells — a mechanism of immune evasion? Nature Med. 2, 1361–1366 (1996).

Hahne, M. et al. Melanoma cell expression of Fas (Apo-1/CD95) ligand: implications for tumor immune escape. Science 274, 1363–1366 (1996).

Allison, J., Georgiou, H. M., Strasser, A. & Vaux, D. L. Transgenic expression of CD95 ligand on islet β cells induces a granulocytic infiltration but does not confer immune privilege upon islet allografts. Proc. Natl Acad. Sci. USA 94, 3943–3947 (1997).

Oltersdorf, T. et al. An inhibitor of the Bcl-2 family proteins induces regression of solid tumours. Nature 435, 677–681 (2005).

Qu, X. et al. Promotion of tumorigenesis by heterozygous disruption of the beclin 1 autophagy gene. J. Clin. Invest. 112, 1809–1820 (2003).


Endothelial Cell Apoptosis

From the Department of Molecular and Cellular Sport Medicine, Institute of Cardiovascular Research and Sport Medicine, German Sport University Cologne, Cologne, Germany.

From the Department of Molecular and Cellular Sport Medicine, Institute of Cardiovascular Research and Sport Medicine, German Sport University Cologne, Cologne, Germany.

Endothelial cells (ECs) covering the inner surface of blood and lymphatic vessels 1 create an interface between circulating blood and lymph and the surrounding tissue. Hence, ECs are crucially involved in maintaining the integrity of all tissues. In addition, the formation of new vessel, eg, during wound healing processes, is determined by ECs. 2 Thus, the maintenance of a structural and functional inner vascular EC surface is of particular importance. However, during pathological conditions ECs may be induced to undergo apoptosis, a major hallmark of the progression of atherosclerosis and other conditions. As these pathologies are the major cause of death in the Western hemisphere, 3 it is of outstanding importance to understand the fundamental mechanisms of EC apoptosis. Improved knowledge about the underlying mechanisms and signaling pathways enables physicians and scientists to combat these maladaptive mechanisms and help care for patients suffering from these diseases.

Article, see p 1551

To date, the understanding of EC apoptosis still remains elusive and fragmentary. It is an established dogma that a variety of intracellular signaling cascades, such as those involving Fas/Fas ligand, Bax/Bad, or caspases, are responsible for EC apoptosis. 4 For example, the protein kinase B/Akt is a major effector of apoptotic inhibition by activating antiapoptotic signaling pathways of the Bcl-2 family. 4 Akt, in turn, is activated and stabilized by a variety of cellular signaling pathways. In recent years, focal adhesions (FAs) have been found to play important roles in Akt activation by their interaction with phosphatidylinositol-3-kinase, a major upstream effector of Akt. FA kinase is one important component in this interaction because it regulates cell survival via phosphatidylinositol-3-kinase/Akt signaling. 5 Besides FA kinase and other FA assemblies, a complex consisting of integrin-linked kinase (Ilk), pinch1/2, and α-parvin/β-parvin (IPP) is significant for tissue development. 6 Ilk represents the central component of this ternary complex, regulating the levels of pinch1/2 and α-parvin/β-parvin. Dependent on its molecular constitution, the IPP complex exerts divergent signaling pathways. Although being involved in a variety of signaling events, the IPP plays a prominent role in Akt signaling. 6 In this regard, the IPP complex also mediates EC survival by inhibiting apoptotic routes 7 (Figure, A).

Figure. Regulation of endothelial cell apoptosis by adenomatous polipolis coli, extracellular matrix/basal membrane, and β1 integrins. A, Recruitment of adenomatous poliposis coli (APC) to the IPP complex results in the stabilization of the entire complex and, therefore, to endothelial cell (EC) survival via activated Akt. B, Disruption of IPP–APC interaction and disorganized extracellular matrix (ECM)/basement membrane (BM) structures result in increased EC apoptosis because of inhibited Akt activation and disturbed inside-out signaling, respectively. C, Hypoxic conditions and disruptions of cell–ECM interactions result in EC apoptosis because of the inhibition of IPP/APC complex formations and disturbed outside-in signaling, respectively. Ilk indicates integrin-linked kinase Pn, Pinch1/2 and Pv, α-/β-parvin.

Although much is known about the intracellular signaling involved in apoptosis, the entire picture of the mediators controlling these processes is likely more complex. Because the extracellular matrix (ECM) surrounding ECs represents a sophisticated regulator of EC behavior, 8 it is reasonable to speculate that ECM-mediated signals via ECM proteins (eg, collagens or laminins) and intracellular ECM binding partners (eg, integrins and FAs) intervene with apoptotic regulatory pathways of ECs (Figure, B).

In this issue of Circulation Research, de Jesus Perez et al 9 demonstrate that adenomatous poliposis coli (APC), a β-catenin–involving tumor suppressor 10,11 with unknown functions in EC apoptosis, is crucial for the stabilization of FAs, especially for the IPP complex. Using an Apc Min/+ mouse model, the authors unravel a mechanism that depends on the interaction between ECM proteins, specifically laminins and α3β1 integrins, resulting in the activation of Ilk. Akt is subsequently phosphorylated upon Ilk activation, thus linking the ECM-induced signaling to EC survival (Figure, A).

This novel mechanism attributes an innovative role to APC in the stabilization and molecular regulation of FA assembly. Thereby, APC mediates inside-out signaling and, thus, is subsequently responsible for EC survival, independent of its role in canonical/noncanonical β-catenin signaling. 10

However, it should be critically scrutinized whether Ilk itself is directly responsible for this signaling. It was a common belief that Ilk possesses a kinase domain directly activating Akt. 12 In the past years, however, concerns were raised contradicting this concept. Indirect genetic evidence against a direct interaction of Ilk and Akt was provided by the group of Fässler 13 who demonstrated by point mutations in the proposed kinase domain of Ilk that this domain is dispensable for mammalian development. 14 Therefore, further studies should carefully look at the underlying mechanisms by which APC and Ilk induce Akt phosphorylation. The discovery of the precise mechanisms would inevitably strengthen the therapeutic approaches to inhibit EC apoptosis. Regardless of Ilk having a direct or indirect role in this process, the stabilization of the APC/IPP complex seems to be a prerequisite for Akt activation and subsequent inhibition of EC apoptosis.

De Jesus Perez et al 9 did not only focus on the role of FAs in EC apoptosis. They additionally addressed the highly important question of whether ECM components are involved in the stabilization of the APC/IPP complex. Their discovery, that laminins are essential for these regulations, opens up new avenues to therapeutically target apoptotic ECs, as the knowledge of involvement of laminins provides a possibility for pharmacological intervention (Figure B). In that regard, it should be noted that de Jesus Perez et al 9 did not provide evidence about the precise laminin isoforms involved. The pool of suspects, however, is small, because it is well-known that laminin-511, laminin-411, and laminin-3B11 are members of the subendothelial basement membrane responsible for EC integrity. In this context, Gu et al 15 demonstrated that laminin-511 and laminin-521 directly bind to α3β1 integrin and thereby activate the phosphatidylinositol-3-kinase/Akt signaling pathway, leading to EC survival in carcinoma cells. However, it will be of high significance to further evaluate the question of ECM integration, and thus the outside-in signaling pathways in the APC-dependent regulation of EC survival, because by its molecular composition, the ECM is a sensitive modulator and, hence, critical for vessel growth. 8,16 Regarding pathological conditions such as tumor growth or atherosclerosis, the ECM dynamically changes its molecular phenotype, specifically induced by activation of proteolytic enzymes resulting in cleavage of ECM proteins, including laminins. 8 This leads to the unresolved, but important question of whether the formation of cleavage fragments changes EC survival dependent on APC/IPP signaling.

In their sophisticated analysis of intracellular signaling complexes dependent on APC and, in parallel, the investigation of ECM components involved in this mechanism, de Jesus Perez et al 9 provide novel integrin-dependent pathways. First, they provide an important inside-out signaling route via the α3β1 integrin/APC/IPP assembly, regulating the intracellular signals consequently resulting in EC survival. Second, the authors single out laminins of a variety of α3β1 integrin–binding ECM proteins as the prominent extracellular substrate responsible for the observed EC survival.

As a third important finding, de Jesus Perez et al 9 show that APC signaling is seriously reduced under hypoxic conditions as a result of a failure of α3β1 downstream signaling. This finding confirms former results, showing that the knockout of β1 integrins results in EC apoptosis without affecting their proliferative capacity 17,18 (Figure C). With regard to hypoxic conditions, however, APC could function as a Janus face regarding its role in tumor biology, a tissue characterized by prevalent hypoxic conditions. These hypoxic conditions reduce APC levels 19 leading to EC apoptosis, 19 which is a well-known antiangiogenic mechanism. At the same time, some tumors (eg, glioblastomas, melanomas, and colon cancers) show aggressive metastasis invading vessel walls, resulting in so-called mosaic vessels. In these vessels, tumor cells residing in the vicinity of ECs have replaced ECs. 20 For that reason, tumor cells can reach the normoxic blood circulation where the APC stabilization could induce survival and distribution of aggressive tumor cells, leading to metastasis formation.

Taken together, these data identify β1 integrins as prominent mediators of EC survival. The data provided by de Jesus Perez et al 9 point to an additional important mechanism of vascular development directly mediated by a β1 integrin–dependent pathway. In future studies, it should be asked whether α3 is the α-subunit of integrin heterodimers responsible for the observed signaling. The identification of the involved integrin heterodimers would significantly stimulate clinical interventions.

As a final aspect of the study by de Jesus Perez et al, 9 the direct connection between metabolic and mechanical signaling pathways should be highlighted. The authors show that metabolic circumstances (hypoxia) lead to the downregulation of APC, which has a negative effect on the stabilization of mechanically sensitive IPP members. Therefore, metabolic cues might thoroughly alter mechanical signaling and, thus, EC behavior by modifying the ECM–cell interactions.

As a concluding remark, the article of de Jesus Perez et al 9 presents highly important new insights into EC apoptosis. They show that APC stabilizes the IPP complex located downstream of β1 integrins, an event that in turn results in Akt activation and thus inhibition of EC apoptosis. In addition, these data shed light on new outside-in and inside-out signaling routes dependent on laminins activating α3β1 integrins that interact with the APC/IPP complex. Further advances in our understanding of the role of specific laminin isoforms, as well as the direct effectors of Akt phosphorylation, will alleviate to the remaining inconsistencies and will advance the quest for new therapies in vascular disease and tumors.

Sources of Funding

The work in our laboratory is supported by the Federal Ministry of Education and Research (BMBF), the German Research Foundation (DFG, SFB 829), the German Academic Exchange Service (DAAD), and the Federal Institute of Sport Science (BISp).


Watch the video: What is Apoptosis? The Apoptotic Pathways and the Caspase Cascade (May 2022).