Information

8.2: The Stuff of Genes - Biology

8.2: The Stuff of Genes - Biology


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

That all eukaryotic cells contain a nucleus was understood by the late 19th century. At around the same time, the notion that the nucleus contains genetic information was gaining traction. In 1910, Albrecht Kossel received the 1910 Nobel Prize in Physiology or Medicine for his discovery of the adenine, thymine, cytosine and guanine (the four DNA bases), as well as of uracil in RNA. Mendel’s Laws of Inheritance, presented in 1865, were not widely understood, probably because they relied on a strong dose of arithmetic and statistics, when the utility of quantitative biology was not much appreciated. But, following the re-discovery three decades later, the number of known inherited traits in any given organism increased rapidly. At that time, DNA was known as a small, simple molecule, made up of only the four nucleotides (see DNA Structure below for additional historical perspective). So, the question was how could such a small, simple account for the inheritance of so many different physical traits? The recognition that enzyme activities were inherited in the same way as morphological characteristics led to the one- gene-one enzyme hypothesis that earned G. W. Beadle, E. L. Tatum and J. Lederberg the 1958 Nobel Prize for Physiology and Medicine. When enzymes were later shown to be proteins, the hypothesis became one-gene-one protein. When proteins were shown to be composed of one or more polypeptides, the final hypothesis became one-gene-one- polypeptide. However, this relationship between genes and proteins failed to shed any light on how DNA might be the genetic material. In fact, quite the contrary! As chains of up to 20 different amino acids, polypeptides and proteins had the potential for enough structural diversity to account for the growing number of heritable traits in a given organism. Thus, proteins seemed more likely candidates for the molecules of inheritance.

The experiments you will read about here began around the start of World War I and lasted until just after World War 2. During this time, we learned that DNA was no mere tetramer, but was in fact a long polymer. This led to some very clever experiments that eventually forced the scientific community to the conclusion that DNA, not protein, was the genetic molecule, despite being composed of just four monomeric units. Finally, we look at the classic work of Watson, Crick, Franklin and Wilkins that revealed the structure of the genetic molecule.

A. Griffith’s Experiment

Fred Neufeld, a German bacteriologist studying pneumococcal bacteria in the early 1900s discovered three immunologically different strains of Streptococcus pneumonia (Types I, II and III). The virulent strain (Type III) was responsible for much of the mortality during the Spanish Flu (influenza) pandemic of 1918-1920. This pandemic killed between 20 and 100 million people, many because the influenza viral infection weakened the immune system of infected individuals, making them susceptible to bacterial infection by Streptococcus pneumonia.

In the 1920s, Frederick Griffith was working with virulent wild type (Type III) and benign (Type II) strains of S. pneumonia. The two strains were easy to tell apart petri dishes because the virulent strain grew in morphologically smooth colonies, while the benign strain formed rough colonies. For this reason, the two bacterial strains were called S and R, respectively. We now know that S cells are coated with a polysaccharide (mucus) capsule, making colonies appear smooth. In contrast, R cell colonies look rough (don’t glisten) because they lack the polysaccharide coating.

Griffith knew that injecting mice with S cells killed them within about a day! Injecting the non-lethal R cells on the other hand, caused no harm. Then, he surmised that, perhaps, the exposure of mice to the R strain of S. pneumonia first would immunize them against lethal infection by S cells. His experimental protocol and results, published in 1928, are summarized below.

To test his hypothesis, Griffith injected mice with R cells. Sometime later, he injected them with S cells. However, the attempt to immunize the mice against S. pneumonia was unsuccessful! The control mice injected with S strain cells and the experimental mice that received the R strain cells first and then S cells, all died in short order! As expected, mice injected with R cells only survived.

Griffith also checked the blood of his mice for the presence of bacterial cells:

· Mice injected with benign R (rough) strain cells survived and after plating blood from the mice on nutrient medium, no bacterial cells grew.

· Many colonies of S cells grew from the blood of dead mice injected with S cells.

Griffith performed two other experiments, shown in the illustration:

1. He injected mice with heat-killed S cells; as expected, these mice survived. Blood from these mice contained no bacterial cells. This was “expected” since heating the S cells should have the same effect as pasteurization has on bacteria in milk!

2. Griffith also injected mice with a mixture of live R cells and heat-killed S cells, in the hope that the combination might induce immunity in the mouse where injecting the R cells alone had failed. You can imagine his surprise when, far from becoming immunized, the injected mice died and abundant S cells had accumulated in their blood.

Griffith realized that something important had happened in his experiments. In the mixture of live R cells and heat-killed S cells, something released from the dead S cells had transformed some R cells. Griffith named this “something” the transforming principle, a molecule present in the debris of dead S cells and sometimes acquired by a few live R cells, turning them into virulent S cells. We now know that R cells lack polysaccharide coat, and that the host cell’s immune system can attack and clear R cells before a serious infection can take hold.

B. The Avery-MacLeod-McCarty Experiment

Griffith didn’t know the chemical identity of the transforming principle. However, his experiments led to studies that proved DNA was the “stuff of genes”. With improved molecular purification techniques developed in the 1930s, O. Avery, C. MacLeod, and M. McCarty transformed R cells in vitro (that is, without the help of a mouse!). They purified heat-killed S-cell components (DNA, proteins, carbohydrates, lipids…) and separately tested the transforming ability of each molecular component on R cells in a test tube.

The experiments of Avery et al. are summarized below.

Since only the DNA fraction of the dead S cells could cause transformation, Avery et al. concluded that DNA must be the Transforming Principle. In spite of these results, DNA was not readily accepted as the stuff of genes. The sticking point was that DNA was composed of only four nucleotides. Even though scientists knew that DNA was a large polymer, they still thought of DNA as that simple molecule, for example a polymer made up of repeating sequences of the four nucleotides:

…AGCTAGCTAGCTAGCTAGCT…

Only the seemingly endless combinations of 20 amino acids in proteins promised the biological specificity necessary to account for an organism’s many genetic traits. Lacking structural diversity, DNA was explained as a mere scaffold for protein genes. To adapt Marshal McLuhan’s famous statement that the medium is the message (i.e., airwaves do not merely convey, but are the message), many still believed that proteins are the medium of genetic information as well as the functional message itself.

The reluctance of influential scientists of the day to accept a DNA transforming principle deprived its discoverers of the Nobel Prize stature it deserved. After new evidence made further resistance to that acceptance untenable, even the Nobel Committee admitted that failure to award a Nobel Prize for the discoveries of Avery et al. was an error. The key experiments of Alfred Hershey and Martha Chase finally put to rest any notion that proteins were genes.

167 Transformation In & Out of Mice; Griffith, McCarthy et al.

C. The Hershey-Chase Experiment

Biochemically, bacterial viruses were known consist of DNA enclosed in a protein capsule. The life cycle of bacterial viruses (bacteriophage, or phage for short) begins with infection of a bacterium, as illustrated below.

Phages are inert particles until they bind to and infect bacterial cells. Phage particles added to a bacterial culture could be seen attach to bacterial surfaces in an electron microscope. Investigators found that they could detach phage particles from bacteria by agitation in a blender (similar to one you might have in your kitchen). Centrifugation then separated the bacterial cells in a pellet at the bottom of the centrifuge tube, leaving the detached phage particles in the supernatant. By adding phage to bacteria and then detaching the phage from the bacteria at different times, it was possible to determine how long it the phage had to remain attached before the bacteria become infected. It turned out that pelleted cells that had been attached to phage for short times would survive and reproduce when re-suspended in growth medium. But pelleted cells left attached to phage for longer times had become infected; centrifugally separated from the detached phage and resuspended in fresh medium, these cells would go on and lyse, producing new phage. Therefore, the transfer of genetic information for virulence from virus to phage took some time. The viral genetic material responsible for infection and virulence was apparently no longer associated with the phage capsule, which could be recovered from the centrifugal supernatant.

Alfred Hershey and Martha Chase designed an experiment to determine whether the DNA enclosed by the viral protein capsule or the capsule protein itself caused phage to infect the bacterium. In the experiment, they separately grew E. coli cells infected with T2 bacteriophage in the presence of either 32P or 35S (radioactive isotopes of phosphorous and sulfur, respectively). The result was to produce phage that contained either radioactive DNA or radioactive proteins, but not both (recall that only DNA contains phosphorous and only proteins contain sulfur). They then separately infected fresh E. coli cells with either 32P- or 35S-labeled, radioactive phage. Their experiment is described below.

Phage and cells were incubated with either 32P or 35S just long enough to allow infection. Some of each culture was allowed to go on and lyse to prove that the cells were infected. The remainder of each mixture was sent to the blender. After centrifugation of each blend, the pellets and supernatants were examined to see where the radioactive proteins or DNA had gone. From the results, the 32P always ended up in the pellet of bacterial cells while the 35S was found in the phage remnant in the supernatant. Hershey and Chase concluded that the genetic material of bacterial viruses was DNA and not protein, just as Avery et al. had suggested that DNA was the bacterial transforming principle.

Given the earlier resistance to “simple” DNA being the genetic material, Hershey and Chase used cautious language in framing their conclusions. They need not have; all subsequent experiments confirmed that DNA was the genetic material. Concurrent with these confirmations were experiments demonstrating that DNA might not be (indeed, was not) such a simple, uncomplicated molecule! For their final contributions to pinning down DNA as the “stuff of genes”, Alfred D. Hershey shared the 1969 Nobel Prize in Physiology or Medicine with Max Delbruck and Salvador E. Luria.

168 Hershey and Chase: Viral Genes are in Viral DNA


8.2: The Stuff of Genes - Biology

Objective: By analyzing pictures and making observations, YWBAT: Identify and explain the categories that ecologists use to organize ecosystems.

  • Fifth grade
    Sixth grade, Seventh grade, Eighth grade 3 more . , Sixth grade, Seventh grade, Eighth grade
  • 53,451 Views
  • 6 Favorites

Introducing biotic and abiotic factors

Objective: YWBAT: 1)Identify and explain the difference between living and non-living things 2)Define biotic, abiotic and ecology

8.26 Class Big Goal and Review of Lab Equipment

Rachel Ryland from Boston Collegiate Charter School

Objective: - Explain our big goal. - Identify lab equipment. - Explain what each piece of equipment is used to measure and the unites it measures in.

3.23 Heredity and Genetics Assesment

Rachel Ryland from Boston Collegiate Charter School

Objective: Students will demonstrate their mastery of objectives in the heredity and genetics unit.

9.21 Types of Cells

Rachel Ryland from Boston Collegiate Charter School

Objective: Differentiate between prokaryotic and eukaryotic cells. Describe the structure and function of the cell membrane.

  • Sixth grade
    Seventh grade, Eighth grade 2 more . , Seventh grade, Eighth grade
  • 6,711 Views
  • 5 Favorites

Methods of population sampling

Objective: YWBAT:Explain the various methods used to estimate the population size of a particular species.

Pocket Mouse Example - Natural Selection

3.14 Monohybrid Crosses

Rachel Ryland from Boston Collegiate Charter School

Objective: Apply the dominant/recessive relationship to monohybrid genetics problem.

8.27 Lab Safety and BCCS Science Big Ideas

Rachel Ryland from Boston Collegiate Charter School

Objective: - Explain the lab safety procedures for the class and their importance. - Identify the 6 big ideas of BCCS science.

  • Fifth grade
    Sixth grade, Seventh grade, Eighth grade 3 more . , Sixth grade, Seventh grade, Eighth grade
  • 32,627 Views
  • 6 Favorites

Food chains

Objective: YWBAT:
1) Create a food chain
2) Explain the difference between a producer, consumer and decomposer

  • Sixth grade
    Seventh grade, Eighth grade 2 more . , Seventh grade, Eighth grade
  • 11,778 Views
  • 2 Favorites

Calculating total population size and population density

Objective: YWBAT: Calculate population density

3.21 Invasive Species

Rachel Ryland from Boston Collegiate Charter School

Objective: Identify what an invasive (non-native) species is. Explain how invasive species can negatively impact areas then enter.

  • Eighth grade
    Ninth grade, Tenth grade, Eleventh grade, Twelfth grade, College Prep. 5 more . , Ninth grade, Tenth grade, Eleventh grade, Twelfth grade, College Prep.
  • 8,065 Views

The "I" in Evolution: Biological Individuality

Anke al-Bataineh from Leadership Preparatory High

Objective: Students understand how genetic variations lead to individuality within populations.

  • Eighth grade
    Ninth grade, Tenth grade, Eleventh grade, Twelfth grade, College Prep. 5 more . , Ninth grade, Tenth grade, Eleventh grade, Twelfth grade, College Prep.

2.7 Meiosis

Rachel Ryland from Boston Collegiate Charter School

Objective: Diagram mitosis. Explain the process of meiosis.

  • Eighth grade
    Ninth grade, Tenth grade, Eleventh grade, Twelfth grade, College Prep. 5 more . , Ninth grade, Tenth grade, Eleventh grade, Twelfth grade, College Prep.
  • 2,667 Views

How to "Sell" a Worldview

Anke al-Bataineh from Leadership Preparatory High

Objective: Students use models from the corporate, political and interpersonal worlds to develop a convincing "pitch" for either individualism or collectivism.


Welch RA, Burland V, Plunkett G, Redford P, Roesch P, Rasko D, Buckles EL, Liou SR, Boutin A, Hackett J, et al: Extensive mosaic structure revealed by the complete genome sequence of uropathogenic Escherichia coli. Proc Natl Acad Sci USA. 2002, 99: 17020-17024. 10.1073/pnas.252529799.

Rasko DA, Ravel J, Okstad OA, Helgason E, Cer RZ, Jiang L, Shores KA, Fouts DE, Tourasse NJ, Angiuoli SV, et al: The genome sequence of Bacillus cereus ATCC 10987 reveals metabolic adaptations and a large plasmid related to Bacillus anthracis pXO1. Nucleic Acids Res. 2004, 32: 977-988. 10.1093/nar/gkh258.

Paulsen IT, Press CM, Ravel J, Kobayashi DY, Myers GSA, Mavrodi DV, DeBoy RT, Seshadri R, Ren Q, Madupu R, et al: Complete genome sequence of the plant commensal Pseudomonas fluorescens Pf-5. Nat Biotechnol. 2005, 23: 873-10.1038/nbt1110.

Mongodin EF, Hance IR, Deboy RT, Gill SR, Daugherty S, Huber R, Fraser CM, Stetter K, Nelson KE: Gene transfer and genome plasticity in Thermotoga maritima, a model hyperthermophilic species. J Bacteriol. 2005, 187: 4935-4944. 10.1128/JB.187.14.4935-4944.2005.

Nesbø CL, Nelson KE, Doolittle WF: Suppressive subtractive hybridization detects extensive genomic diversity in Thermotoga maritima. J Bacteriol. 2002, 184: 4475-4488. 10.1128/JB.184.16.4475-4488.2002.

Tettelin H, Masignani V, Cieslewicz MJ, Donati C, Medini D, Ward NL, Angiuoli SV, Crabtree J, Jones AL, Durkin AS, et al: Genome analysis of multiple pathogenic isolates of Streptococcus agalactiae: implications for the microbial "pan-genome". Proc Natl Acad Sci USA. 2005, 102: 13950-13955. 10.1073/pnas.0506758102.

Hao W, Golding GB: Patterns of bacterial gene movement. Mol Biol Evol. 2004, 21: 1294-1307. 10.1093/molbev/msh129.

Ortutay C, Gaspari Z, Toth G, Jager E, Vida G, Orosz L, Vellai T: Speciation in Chlamydia: genomewide phylogenetic analyses identified a reliable set of acquired genes. J Mol Evol. 2003, 57: 672-680. 10.1007/s00239-003-2517-3.

Daubin V, Lerat E, Perriere G: The source of laterally transferred genes in bacterial genomes. Genome Biol. 2003, 4: R57-10.1186/gb-2003-4-9-r57.

Hao W, Golding GB: The fate of laterally transferred genes: life in the fast lane to adaptation or death. Genome Res. 2006, 16: 636-643. 10.1101/gr.4746406.

Marri PR, Bannantine JP, Paustian ML, Golding GB: Lateral gene transfer in Mycobacterium avium subspecies paratuberculosis. Can J Microbiol. 2006, 52: 560-569. 10.1139/W06-001.

Kunin V, Ouzounis CA: The balance of driving forces during genome evolution in prokaryotes. Genome Res. 2003, 13: 1589-1594. 10.1101/gr.1092603.

Mirkin BG, Fenner TI, Galperin MY, Koonin EV: Algorithms for computing parsimonious evolutionary scenarios for genome evolution, the last universal common ancestor and dominance of horizontal gene transfer in the evolution of prokaryotes. BMC Evol Biol. 2003, 3: 2-10.1186/1471-2148-3-2.

McLysaght A, Baldi PF, Gaut BS: Extensive gene gain associated with adaptive evolution of poxviruses. Proc Natl Acad Sci USA. 2003, 100: 15655-15660. 10.1073/pnas.2136653100.

Mira A, Ochman H, Moran NA: Deletional bias and the evolution of bacterial genomes. Trends Genet. 2001, 17: 589-596. 10.1016/S0168-9525(01)02447-7.

Ochman H, Davalos LM: The nature and dynamics of bacterial genomes. Science. 2006, 311: 1730-1733. 10.1126/science.1119966.

Lerat E, Ochman H: Recognizing the pseudogenes in bacterial genomes. Nucleic Acids Res. 2005, 33: 3125-3132. 10.1093/nar/gki631.

Liu Y, Harrison PM, Kunin V, Gerstein M: Comprehensive analysis of pseudogenes in prokaryotes: widespread gene decay and failure of putative horizontally transferred genes. Genome Biol. 2004, 5: R64-10.1186/gb-2004-5-9-r64.

Andersson JO, Andersson SG: Pseudogenes, junk DNA, and the dynamics of Rickettsia genomes. Mol Biol Evol. 2001, 18: 829-839.

Feil EJ: Small change: keeping pace with microevolution. Nat Rev Microbiol. 2004, 2: 483-495. 10.1038/nrmicro904.

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997, 25: 3389-3402. 10.1093/nar/25.17.3389.

Hanage W, Fraser C, Spratt B: Fuzzy species among recombinogenic bacteria. BMC Biol. 2005, 3: 6-10.1186/1741-7007-3-6.

Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22: 4673-4680. 10.1093/nar/22.22.4673.

Swofford D: PAUP* 4.0 Beta Version, Phylogenetic Analysis Using Parsimony (and Other Methods). 1998, Sunderland, MA Sinauer Associates

van Dongen S: A cluster algorithm for graphs. Technical Report INS-R0010. 2000, Amsterdam: National Research Institute for Mathematics and Computer Science in the Netherlands

Konstantinidis KT, Tiedje JM: Genomic insights that advance the species definition for prokaryotes. Proc Natl Acad Sci USA. 2005, 102: 2567-2572. 10.1073/pnas.0409727102.

Pearson WR: Effective protein sequence comparison. Methods Enzymol. 1996, 266: 227-258.

Fraser-Liggett CM: Insights on biology and evolution from microbial genome sequencing. Genome Res. 2005, 15: 1603-1610. 10.1101/gr.3724205.

Nierman WC, DeShazer D, Kim HS, Tettelin H, Nelson KE, Feldblyum T, Ulrich RL, Ronning CM, Brinkac LM, Daugherty SC, et al: Structural flexibility in the Burkholderia mallei genome. Proc Natl Acad Sci USA. 2004, 101: 14246-14251. 10.1073/pnas.0403306101.


Recombination: Definition, Mechanism and Types | Microbiology

In this article we will discuss about:- 1. Definition of Recombination 2. Mechanism of Recombination 3. Types.

Definition of Recombination:

The most important features of organisms are to adapt in the environment and to maintain their DNA sequence in the cells generation to generations with very little alterations. In long term survival of organisms depends on genetic variations, a key feature through which the organism can adapt to an environment which changes with time.

This variability among the organisms occurs through the ability of DNA to undergo genetic rearrangements resulting in a little change in gene combination. Rearrangement of DNA occurs through genetic recombination.

Thus, recombination is the process of formation of new recombinant chromosome by combining the genetic material from two organisms. The new recombinants show changes in phenotypic characters.

Most of the eukaryotes show a complete sexual life cycle including meiosis, an important event that generates new allelic combinations by recombination. It is made possible through chromosomal exchange resulting from crossing over between the two homologous chromosomes containing identical gene sequences.

Much work was done on eukaryotic genetics until 1945 that laid the foundation of classical genetics. The work on bacterial genetics was done between 1945 and 1965 that advanced the understanding of microbial genetics at molecular level.

Mechanism of Recombination:

Basically, there are three theories viz., breakage and reunion, breakage and copying and complete copy choice that explain the mechanism of recombination (Fig.8.23).

(i) Breakage and Reunion:

Two homologous duplex of chromosome laying in paired form breaks between the gene loci a and b, and a + and b + (Fig. 8.23A). The broken segments rejoin crosswise and yield recombinants containing a and b + segment, and a + and b segment. This type of recombination does not require the synthesis of new DNA. This concept has been used to explain genetic recombination.

(ii) Breakage and Copying:

One helix of paired homologous chromosome (ab and a + b + ) breaks between a and b (Fig. 8.23B). Segment b is replaced by a newly synthesized segment copied from b + and attached to a section. Thus the recombinants contain and ab + and a + b + .

(iii) Complete Copy Choice:

In, 1931, Belling proposed this theory for recombination of chromosome in higher animals. However, it has been questioned by several workers. Therefore, it has only historical importance.

According to this theory a portion of one parental strand of homologous chromosome acts as template for the synthesis of a copy of its DNA molecule. The process of copying shifts to the other parental strand. Thus, the recombinants contain some genetic information of one parental strand and some of the other strand (Fig. 8.23 C).

Types of Recombination:

Many kinds of recombination occur in microorganisms.

These are classified basically into the following three groups:

(ii) Non-reciprocail recombination, and

(iii) Site specific recombination.

(i) General Recombination:

General recombination occurs only between the complementary strands of two homologous DNA molecules. Smith (1989) reviewed the homologous recombination in prokaryotes. General recombination in E. coli is guided by base pairing interactions between the complementary strands of two homologous DNA molecules.

Double helix of two DNA molecules breaks and the two broken ends join to their opposite partners to reunite to form double helix. The site of exchange can occur anywhere in the homologous nucleotide sequence where a strand of one DNA molecule becomes base paired to the second strand to yield heteroduplex just between two double helices (Fig. 8.24).

In the heteroduplex no nucleotide sequences are changed at the site of exchange due to cleavage and rejoining events. However, heteroduplex joints can have a small number of mismatched base pairs.

General recombination is also known as homologous recombination as it requires homologous chromosomes. In bacteria and viruses general recombination is carried out by the products of rec genes such as RecA protein. The RecA protein is very important for DNA repair therefore, it is recA dependent recombination.

Holliday Model for General Recombination:

Holliday (1974) presented a model to show the general recombination (Fig. 8.25). According to this model recombination occurs in five steps such as strand breakage, strand pairing, strand invasion/assimilation, chiasma (crossing over) formation, breakage and reunion and mismatch repair.

Fig.8.25 : The Holliday model for reciprocal general recombination.

General recombination occurs through crossing over by pairing between the complementary single strands of DNA duplex (a). Two homologous regions of DNA double helix undergo an exchange reaction.

The homologous region contains a long sequence of complementary base pairing between a strand from one or two original double helices and a complementary strand from the other. However, it is unknown how the homologous region of DNA recognises each other.

A list of recombination genes and their function have been given in Table 8.2. The RecBCD proteins of recBCD or recJ genes are required for recombination in E. coli. This protein enters the DNA from one end of double helix, and travels along the DNA at double helix, at the rate of about 300 nucleotides per second.

It creates a loop of ssDNA along travelling DNA (b). It uses energy derived from hydrolysis of ATP molecules. A special recognition site (a) sequence of eight nucleotides scattered throughout E. coli chromosome (b) is nicked in the travelling loop of DNA formed by RecBCD protein.

Table 8.2 : Recombination (rec) genes and their function.

(b) Strand pairing:

The RecBCD proteins act as DNA helicase because these hydrolyse ATP and travel along DNA helix. Thus, the RecBCD proteins result in formation of single stranded whisker at the recognition site which is displaced from the helix (c). This initiates a base pairing interaction between the two complementary sequences of DNA double helix.

(c) Strand invasion/assimilation:

A single strand (whisker) generated from one DNA double helix invades the another double helix (d). In E. coli recA gene produces RecA protein which is important for recombination between the chromosomes like single strand binding (SSB) proteins, The RecA protein binds firmly to single stranded DNA to form a nucleoprotein filament.

Roca and Cox (1990) have reviewed the structure and function of RecA protein. RecA protein promotes rapid renaturation of complementary ssDNA hydrolyzing ATP in the process. RecA protein has several binding sites therefore, it can bind a ssDNA and subsequently a dsDNA. RecA protein binds first to ssDNA, then search for homology between the donor strand and the recipient molecule.

Due to the presence of these sites RecA protein catalyses a multistep reaction (called synapsis) between the homologous region of ssDNA and a DNA double helix. E. coli SSB protein helps the Rec protein to carry out these reactions. When a region of homology is identified by an initial base pairing between the complementary sequences, the crucial step in synapsis occurs.

In vivo experiments have shown that several types of complexes are formed between a ssDNA covered with RecA protein and a dsDNA helix. First a non-base paired complex is formed which is converted into a three stranded structure (ssDNA, dsDNA and RecA protein) when a homologous region is found.

This complex is unstable and spins out a DNA heteroduplex plus a displaced ssDNA from the original helix. Once the homologous regions are encountered and the ssDNA and dsDNA are complexed, a stable D-loop is formed (d).

The next step is the assimilation of strand and nick ligation (e). The donor strand gradually displaces the recipient strand which is called branch migration. After formation of synapsis, the heteroduplex region is enlarged through protein-directed branch migration catalysed by RecA protein.

RecA protein directed branch migration proceeds at a uniform rate in one direction due to addition of more RecA protein to one end of RecA protein filament on the ssDNA. Branch migration can take place at any point where two single strands with the sequence make attempts to pair with the same complementary strand.

An unpaired region of the other single strand resulting in movement of branch point without changing the total number of DNA base pairs. Special DNA helicases that catalyse protein directed branch migration are involved in recombination. In contrast, the spontaneous branch migration proceeds in both the directions almost at the same rate. Therefore, it makes a little progress over a long distance.

(e) Chiasma or crossing over formation:

Exchange of a single strand between two double helices is a different step in a general recombination event. After the initial cross strand exchange, further strand exchanges between the two closely opposed helices is thought to proceed rapidly. A nuclease cleaves and partly degrades the D-loop at some points.

At this stage possibly different organisms follow different pathways. However, in most of the cases an important structure called cross-strand exchange (also called Holliday Juncture or chi form or chiasmas, is formed by the two participating DNA helices (g). A chi form of single stranded connections in the cross over region has also been observed under the electron microscope by Dressier and Potter (1982).

The chi form of two homologous helices that initially paired and held together by mutual exchange of two of the four strands where one strand originates from each of the helices (g).

The chi form has two important properties, (i) the point of exchange can migrate rapidly back and forth along the helices by a double branch migration, and (ii) it contains two pairs of strands, one pair of crossing strands and the other pair of non-crossing strands.

(f) Breakage and reunion:

The chi structure can isomerize several rotations (h). This results in alteration of two original non-crossing strands into the crossing strands, and the crossing strands into the non-crossing strands. In order to regenerate two separate DNA helices, breakage and reunion in two crossing strands are required.

If breakage and reunion occur before isomerization the two crossing strands would not occur. Therefore, isomerization is required for the breakage and reunion of two homologous DNA double helices resulting from general genetic recombination.

Breakage and reunion occur either in the vertical or horizontal plane. If breakage occurs horizontally the recombinants would contain genotype ABlab with a little change in base sequences at the inner region (i).

However, if breakage occurs vertically the recombinants would contain Ab/aB (J). The RurC protein and RecG protein expressed from ruvC and recG genes respectively are thought to be alternative endonucleases specific for Holliday structure.

(g) Mismatch Repair (Mismatch Proof Read­ing System):

It is such a repair system which corrects mismatched base pairs of unpaired regions after recombination. This system recognises mis­matched function of DNA polymerase. The mecha­nism involves the excision of one of the other mismatched bases along with about 3,000 nucleotides. This RecFJO is involved in the repair of short mismatch either in the initial stage or at the end of recombination.

The two proteins MutS and MutL are present in bacteria and eukaryotes. The MutS protein binds to mismatched base pair, whereas MutL scan the DNA for a nick (Fig. 8.26).

When a nick is formed MutL triggers the degradation of the nicked strand all the way back through the mismatch, because the nicks are largely confined to the newly replicated strands in eukaryotes, replication errors are selectively removed. In bacteria the mechanism is the same except that an additional protein MutH nicks the un-methylated GATC sequences and begins the process.

It has been demonstrated in yeast and bacteria that the same mismatch repair system which removes replication errors as in Fig. 8.26 also interrupts the genetic recombination events between imperfectly matched DNA sequences. It is known that homologous genes in two closely related bacteria (E. coli and S.typhimurium) generally will not recombine, even after having 80% identical nucleotide sequences.

However, when mismatch repair system is inactivated by mutation, the frequency of such interspecies recombination increases by 100-fold. This mechanism protects the bacterial genome from sequence changes that would be caused by recombination with foreign DNA molecules entering in the cell.

(ii) Non-reciprocal Recombination (Gene Conversion):

The fundamental law of genetics is that the two partners contribute the equal amount of genes to the offsprings. It means that the offsprings inherit the half complete set of genes from the male and half from the female. One diploid cell undergoes meiosis producing four haploid cells therefore, the number of genes contributed by male gets halved and so the genes of female.

In higher animals like man it is not possible to analyse these genes taking a single cell. However, in certain organisms such as fungi it is possible to recover and analyse all the four daughter cells produced from a single cell through meiosis.

Occasionally, three copies of maternal allele and only one copy of paternal allele is formed by meiosis. This indicates that one of two copies of parental alleles has been altered to the maternal allele. This gene alteration is of non-reciprocal type and is called gene conversion. Gene conversion is thought to be an important event in the evolution of certain genes and occurs as a result of the mechanism of general recombination and DNA repair.

Non-reciprocal general recombination is given in Fig. 8.27. Kobayashi (1992) has discussed the mechanism for gene conversion and homologous recombination.

This process starts when a nick is made in one of the strands (a). From this point DNA polymerase synthesizes an extra copy of a strand and displaces the original copy as a single strand (b). This single strand starts pairing with the homologous region as in lower duplex of DNA molecule (b). The short unpaired strand produced in step (b) is degraded when the transfer of nucleotide sequence is completed. The results are observed (in the next cycle) when DNA replication has separated the two non-matching strands (c).

(iii) Site-Specific Recombination:

Site specific recombination alters the relative position of nucleotide sequences in chromosome. The base pairing reaction depends on protein mediated recognition of the two DNA sequences that will combine. Very long homologous sequence is not required.

Unlike general recombination, site specific recombination is guided by a recombination enzyme that recognises specific nucleotide sequences present on one of both recombining DNA molecules. Base pairing is not involved, however, if occurs the heteroduplex joint is only a few base pair long.

It was first discovered in phage λ by which its genome moves into and out of the E. coli chromosome. After penetration phage encoded an enzyme, lambda integrase which catalyses the recombination process (Fig. 8.28). Lambda integrase binds to a specific attachment site of DNA sequence on each chromosome.

It makes cuts and breaks a short homologous DNA sequences. The integrase switches the partner strands and rejoins them to form a heteroduplex joint of 7 bp long. The integrase resembles a DNA topoisomerase in rejoining the strands which have previously been broken.

Site specific recombination is of the following two types:

(a) Conservative site-specific recombina­tion:

Production of a very short heteroduplex by requiring some DNA sequence that is the same on the two DNA molecules is known as conservative site-specific recombination. The detail procedure is described in Fig. 8.28.

(b) Trans-positional site-specific recombi­nation:

There is another type of recombination system known as trans-positional site-specific (TSS) recombination. The TSS recombination does not produce heteroduplex and requires no specific sequences on the largest DNA.

There are several mobile DNA sequences including many viruses and transposable elements that encode integrates. The enzyme integrates by involving a mechanism different from phage λ insert its DNA into a chromosome. Each enzyme of integrates recog­nises a specific DNA sequence like phage λ.

K. Mizuuchi (1992a) reviewed the mecha­nism of trans-positional recombination based on the studies of bacteriophage Mu and the other elements. The enzyme integrase was first purified from Mu. Similar to integrase of phage λ, the Mu integrase also carries out of its cutting and rejoining reactions without requirement of ATP. Also they do not require a specific DNA sequence in the target chromosome and do not form a joint of heteroduplex.

Different steps of TSS recombinational events are shown in Fig. 8.29. The integrase makes a cut in one strand at each end of the viral DNA sequences, and exposes the 3′-OH group that protrudes out. Therefore, each of these 3′-OH ends directly invades a phosphodiester bond on opposite strands of a randomly selected site on a target chromosome.

This facilitates to insert the viral DNA sequence into the target chromosome, leaving two short single stranded gaps on each side of recombinational DNA molecule.

These gaps are filled in later on by DNA repair process (i.e. DNA polymerase) to complete the recombination process. This mechanism results in formation of short duplication (short repeats of about 3 to 12 nucleotide long) of the adjacent target DNA sequence. Formation of short repeats is the hall-marks of a TSS recombination.

Fig. 8.29 : Mechanism of trans-positional site-specific recombination SDR, short direct repeats of target DNA sequence.


A Family Consents to a Medical Gift, 62 Years Later

Henrietta Lacks was only 31 when she died of cervical cancer in 1951 in a Baltimore hospital. Not long before her death, doctors removed some of her tumor cells. They later discovered that the cells could thrive in a lab, a feat no human cells had achieved before.

Soon the cells, called HeLa cells, were being shipped from Baltimore around the world. In the 62 years since — twice as long as Ms. Lacks’s own life — her cells have been the subject of more than 74,000 studies, many of which have yielded profound insights into cell biology, vaccines, in vitro fertilization and cancer.

But Henrietta Lacks, who was poor, black and uneducated, never consented to her cells’ being studied. For 62 years, her family has been left out of the decision-making about that research. Now, over the past four months, the National Institutes of Health has come to an agreement with the Lacks family to grant them some control over how Henrietta Lacks’s genome is used.

“In 20 years at N.I.H., I can’t remember something like this,” Dr. Francis S. Collins, the institute’s director, said in an interview.

The agreement, which does not provide the family with the right to potential earnings from future research on Ms. Lacks’s genome, was prompted by two projects to sequence the genome of HeLa cells, the second of which was published Wednesday in the journal Nature.

Though the agreement, which was announced Wednesday, is a milestone in the saga of Ms. Lacks, it also draws attention to a lack of policies to balance the benefits of studying genomes with the risks to the privacy of people whose genomes are studied — as well as their relatives.

As the journalist Rebecca Skloot recounted in her 2010 best-seller, “The Immortal Life of Henrietta Lacks,” it was not until 1973, when a scientist called to ask for blood samples to study the genes her children had inherited from her, that Ms. Lacks’s family learned that their mother’s cells were, in effect, scattered across the planet.

Some members of the family tried to find more information. Some wanted a portion of the profits that companies were earning from research on HeLa cells. They were largely ignored for years.

Image

Ms. Lacks is survived by children, grandchildren and great-grandchildren, many still living in or around Baltimore.

And this March they experienced an intense feeling of déjà vu.

Scientists at the European Molecular Biology Laboratory published the genome of a line of HeLa cells, making it publicly available for downloading. Another study, sponsored by the National Institutes of Health at the University of Washington, was about to be published in Nature. The Lacks family was made aware of neither project.

“I said, ‘No, this is not right,’ ” Jeri Lacks Whye, one of Henrietta Lacks’s grandchildren, said in an interview. “They should not have this up unless they have consent from the family.”

Officials at the National Institutes of Health now acknowledge that they should have contacted the Lacks family when researchers first applied for a grant to sequence the HeLa genome. They belatedly addressed the problem after the family raised its objections.

The European researchers took down their public data, and the publication of the University of Washington paper was stopped. Dr. Collins and Kathy L. Hudson, the National Institutes of Health deputy director for science, outreach and policy, made three trips to Baltimore to meet with the Lacks family to discuss the research and what to do about it.

“The biggest concern was privacy — what information was actually going to be out there about our grandmother, and what information they can obtain from her sequencing that will tell them about her children and grandchildren and going down the line,” Ms. Lacks Whye said.

The Lacks family and the N.I.H. settled on an agreement: the data from both studies should be stored in the institutes’ database of genotypes and phenotypes. Researchers who want to use the data can apply for access and will have to submit annual reports about their research. A so-called HeLa Genome Data Access working group at the N.I.H. will review the applications. Two members of the Lacks family will be members. The agreement does not provide the Lacks family with proceeds from any commercial products that may be developed from research on the HeLa genome.

With this agreement in place, the University of Washington researchers were then able to publish their results. Their analysis goes beyond the European study in several ways. Most important, they show precisely where each gene is situated in HeLa DNA.

A human genome is actually two genomes, each passed down from a parent. The two versions of a gene may be identical, or they may carry genetic variations setting them apart.

“If you think of the variations as beads on a string, you really have two strings,” said Dr. Jay Shendure, who led the Washington genome study. “The way we sequence genomes today, for the most part we just get a list of where the genes are located, but no information about which ones are on which string.”

Dr. Shendure and his colleagues have developed new methods that allow them to gather that information. By reconstructing both strings of the HeLa genome, they could better understand how Ms. Lacks’s healthy cells had been transformed over the past 60 years.

For example, they could see how Ms. Lacks got cancer. Cervical cancer is caused by human papillomavirus infections. The virus accelerates the growth of infected cells, which may go on to become tumors.

Dr. Shendure and his colleagues discovered the DNA of a human papillomavirus embedded in Ms. Lacks’s genome. By landing at a particular spot, Ms. Lacks’s virus may have given her cancer cells their remarkable endurance.

“That’s one of the frequent questions that I and the Lacks family get whenever we talk about this stuff,” Ms. Skloot said. “The answer was always, ‘We don’t know.’ Now, there’s at least somewhat of an answer: because it happened to land right there.”

Richard Sharp, the director of biomedical ethics at the Mayo Clinic, said he thought the agreement “was pretty well handled.” But he warned that it was only a “one-off solution,” rather than a broad policy to address the tension between genome research and the privacy of relatives, now that recent research has demonstrated that it is possible to reveal a person’s identity through sequencing.

Dr. Sharp considered it impractical to set up a working group of scientists and relatives for every genome with these issues. “There’s absolutely a need for a new policy,” he said.

Eric S. Lander, the founding director of the Broad Institute, a science research center at Harvard and M.I.T., said resolving these issues was crucial to taking advantage of the knowledge hidden in our genomes.

“If we are going to solve cancer, it’s going to take a movement of tens of thousands, or hundreds of thousands, of patients willing to contribute information from their cancer genomes towards a common good,” Dr. Lander said. “We are going to need to have ways to have patients feel comfortable doing that. We can’t do it without a foundation of respect and trust.”


Watch the video: Biology - Secret of Life - - Secrets of the Human Genome 1 - The Genomic Landscape (May 2022).