Information

Do miRNA and antisense RNA do essentially the same thing?

Do miRNA and antisense RNA do essentially the same thing?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Don't they both just disrupt RNA so it can't make a protein? If so, then what is the difference between the 2?


Antisense simply means that a sequence is the complement of another. miRNAs are naturally occurring antisense RNAs yes. The "difference" is that antisense RNA is often used for sequences developed in the lab and used for processes such as RNAi.

miRNAs, on the other hand, are encoded by the genome and are used by the cell for regulating gene expression. They do this through the RISC complex, just like artificial antisense RNAs such as siRNAs.

Basically, antisense is the general term, and can be applied to any sequence whose complement exists in the genome. miRNAs are a particular class of antisense RNAs.


Antisense RNA is any RNA that is complementary to another RNA. Therefore, miRNA is a type of antisense RNA. Antisense RNA can inhibit translation of mRNA by hybridizing and preventing ribosomal binding/translocation. Antisense RNA in this context could be any length and bind anywhere between the RBS and end of the CDS. miRNA also prevents translation but it does so through the RNAi pathway by facilitating binding of the RISC complex to mRNA (often in the 3'-UTR, which is after the CDS). miRNA are around 22 nts long (but it is species dependent).


How does antisense RNA inhibit translation?

The second sequence of RNA (nonsense RNA) complementary to the mRNA is possible to form duplexes and inhibits translation of mRNA as it physically obstructing the translation machinery. Antisense RNAs directly bind to the coding region of sense RNA, resulting in direct inhibition of translation or mRNA destabilization.

One may also ask, does antisense RNA prevent translation or transcription? Antisense RNA (asRNA), also referred to as antisense transcript, natural antisense transcript (NAT) or antisense oligonucleotide, is a single stranded RNA that is complementary to a protein coding messenger RNA (mRNA) with which it hybridizes, and thereby blocks its translation into protein.

Also to know is, how does antisense RNA regulate the expression of DNA?

Antisense RNAs play the crucial role in regulating gene expression at multiple levels, such as at replication, transcription, and translation. In addition, artificial antisense RNAs can effectively regulate the expression of related genes in host cells.

How does antisense technology work?

In Antisense technology, synthetically &ndash produced complementary molecules seek out and bind to messenger RNA (mRNA), blocking the final step of protein production. mRNA is the nucleic acid molecule that carries genetic information from the DNA to the other cellular machinery involved in the protein production.


New tool for RNA silencing

Antisense reagents have been developed for C. elegans micro RNA. Researchers writing in BioMed Central's open access journal Silence have created the first class of reagents to potently and selectively inhibit miRNAs in this widely used model organism.

Wen-hong Li, from the University of Texas Southwestern Medical Center, USA, worked with a team of researchers including Dr. Genhua Zheng and Dr. Victor Ambros (University of Massachusetts Medical School) to develop this latest addition to the genetics toolkit. He said, "Caenorhabditis elegans has long been used as a model organism for studying the regulation and function of small non-coding RNA molecules, and yet no antisense reagents have been available to reliably inhibit miRNAs in worms. Our fluorescently labeled reagents were synthesized by conjugating dextran with 2'-O-methyl oligoribonucleotide, and can be conveniently introduced into the germline of adult hermaphrodites and are transmitted to their progeny."

Li's team found that their new reagents efficiently and specifically inhibited targeted miRNA in different tissues, including the hypodermis, the vulva and the nervous system. They can be used combinatorially to inhibit more than one miRNA in the same animal. They conclude, "Combined with numerous mutants or reporter stains available, these reagents should provide a convenient approach to examine genetic interactions that involve miRNA, and may facilitate studying functions of miRNAs, especially ones whose deletion strains are difficult to generate. Further, the remarkable efficacy of these antisense reagents seen in worms also suggested C. elegans as a powerful, convenient, and economical biological system to facilitate developing new chemistry and novel probes for studying miRNA and other small non-coding RNAs."

Story Source:

Materials provided by BioMed Central. Note: Content may be edited for style and length.


Contents

The first miRNA was discovered in the early 1990s. [13] However, miRNAs were not recognized as a distinct class of biological regulators until the early 2000s. [14] [15] [16] [17] [18] miRNA research revealed different sets of miRNAs expressed in different cell types and tissues [8] [19] and multiple roles for miRNAs in plant and animal development and in many other biological processes. [20] [21] [22] [23] [24] [25] [26] Aberrant miRNA expression are implicated in disease states. MiRNA-based therapies are under investigation. [27] [28] [29] [30]

The first miRNA was discovered in 1993 by a group led by Ambros and including Lee and Feinbaum. However, additional insight into its mode of action required simultaneously published work by Ruvkun's team, including Wightman and Ha. [13] [31] These groups published back-to-back papers on the lin-4 gene, which was known to control the timing of C. elegans larval development by repressing the lin-14 gene. When Lee et al. isolated the lin-4 miRNA, they found that instead of producing an mRNA encoding a protein, it produced short non-coding RNAs, one of which was a

22-nucleotide RNA that contained sequences partially complementary to multiple sequences in the 3' UTR of the lin-14 mRNA. [13] This complementarity was proposed to inhibit the translation of the lin-14 mRNA into the LIN-14 protein. At the time, the lin-4 small RNA was thought to be a nematode idiosyncrasy.

In 2000, a second small RNA was characterized: let-7 RNA, which represses lin-41 to promote a later developmental transition in C. elegans. [14] The let-7 RNA was found to be conserved in many species, leading to the suggestion that let-7 RNA and additional "small temporal RNAs" might regulate the timing of development in diverse animals, including humans. [15]

A year later, the lin-4 and let-7 RNAs were found to be part of a large class of small RNAs present in C. elegans, Drosophila and human cells. [16] [17] [18] The many RNAs of this class resembled the lin-4 and let-7 RNAs, except their expression patterns were usually inconsistent with a role in regulating the timing of development. This suggested that most might function in other types of regulatory pathways. At this point, researchers started using the term "microRNA" to refer to this class of small regulatory RNAs. [16] [17] [18]

The first human disease associated with deregulation of miRNAs was chronic lymphocytic leukemia. In this disorder, the miRNAs have a dual role working as both tumor suppressors and oncogenes. [32]

Under a standard nomenclature system, names are assigned to experimentally confirmed miRNAs before publication. [33] [34] The prefix "miR" is followed by a dash and a number, the latter often indicating order of naming. For example, miR-124 was named and likely discovered prior to miR-456. A capitalized "miR-" refers to the mature form of the miRNA, while the uncapitalized "mir-" refers to the pre-miRNA and the pri-miRNA. [35] The miRNAs encoding genes are also named using the same three-letter prefix according to the conventions of the organism gene nomenclature. For examples, the official miRNAs gene names in some organisms are “mir-1 in C. elegans and Drosophila, Mir-1 in Rattus norvegicus and MIR-25 in human.

miRNAs with nearly identical sequences except for one or two nucleotides are annotated with an additional lower case letter. For example, miR-124a is closely related to miR-124b. For example:

Pre-miRNAs, pri-miRNAs and genes that lead to 100% identical mature miRNAs but that are located at different places in the genome are indicated with an additional dash-number suffix. For example, the pre-miRNAs hsa-mir-194-1 and hsa-mir-194-2 lead to an identical mature miRNA (hsa-miR-194) but are from genes located in different genome regions.

Species of origin is designated with a three-letter prefix, e.g., hsa-miR-124 is a human (Homo sapiens) miRNA and oar-miR-124 is a sheep (Ovis aries) miRNA. Other common prefixes include "v" for viral (miRNA encoded by a viral genome) and "d" for Drosophila miRNA (a fruit fly commonly studied in genetic research).

When two mature microRNAs originate from opposite arms of the same pre-miRNA and are found in roughly similar amounts, they are denoted with a -3p or -5p suffix. (In the past, this distinction was also made with "s" (sense) and "as" (antisense)). However, the mature microRNA found from one arm of the hairpin is usually much more abundant than that found from the other arm, [4] in which case, an asterisk following the name indicates the mature species found at low levels from the opposite arm of a hairpin. For example, miR-124 and miR-124* share a pre-miRNA hairpin, but much more miR-124 is found in the cell.

Plant miRNAs usually have near-perfect pairing with their mRNA targets, which induces gene repression through cleavage of the target transcripts. [20] In contrast, animal miRNAs are able to recognize their target mRNAs by using as few as 6–8 nucleotides (the seed region) at the 5' end of the miRNA, [11] [36] [37] which is not enough pairing to induce cleavage of the target mRNAs. [2] Combinatorial regulation is a feature of miRNA regulation in animals. [2] [38] A given miRNA may have hundreds of different mRNA targets, and a given target might be regulated by multiple miRNAs. [12] [39]

Estimates of the average number of unique messenger RNAs that are targets for repression by a typical miRNA vary, depending on the estimation method, [40] but multiple approaches show that mammalian miRNAs can have many unique targets. For example, an analysis of the miRNAs highly conserved in vertebrates shows that each has, on average, roughly 400 conserved targets. [12] Likewise, experiments show that a single miRNA species can reduce the stability of hundreds of unique messenger RNAs. [41] Other experiments show that a single miRNA species may repress the production of hundreds of proteins, but that this repression often is relatively mild (much less than 2-fold). [42] [43] The first human disease discovered to be associated with deregulation of miRNAs was chronic lymphocytic leukemia. Other B cell malignancies followed.

As many as 40% of miRNA genes may lie in the introns or even exons of other genes. [44] These are usually, though not exclusively, found in a sense orientation, [45] [46] and thus usually are regulated together with their host genes. [44] [47] [48]

The DNA template is not the final word on mature miRNA production: 6% of human miRNAs show RNA editing (IsomiRs), the site-specific modification of RNA sequences to yield products different from those encoded by their DNA. This increases the diversity and scope of miRNA action beyond that implicated from the genome alone.

Transcription Edit

miRNA genes are usually transcribed by RNA polymerase II (Pol II). [49] [50] The polymerase often binds to a promoter found near the DNA sequence, encoding what will become the hairpin loop of the pre-miRNA. The resulting transcript is capped with a specially modified nucleotide at the 5' end, polyadenylated with multiple adenosines (a poly(A) tail), [49] [45] and spliced. Animal miRNAs are initially transcribed as part of one arm of an ∼80 nucleotide RNA stem-loop that in turn forms part of a several hundred nucleotide-long miRNA precursor termed a pri-miRNA. [49] [45] When a stem-loop precursor is found in the 3' UTR, a transcript may serve as a pri-miRNA and a mRNA. [45] RNA polymerase III (Pol III) transcribes some miRNAs, especially those with upstream Alu sequences, transfer RNAs (tRNAs), and mammalian wide interspersed repeat (MWIR) promoter units. [51]

Nuclear processing Edit

A single pri-miRNA may contain from one to six miRNA precursors. These hairpin loop structures are composed of about 70 nucleotides each. Each hairpin is flanked by sequences necessary for efficient processing.

The double-stranded RNA (dsRNA) structure of the hairpins in a pri-miRNA is recognized by a nuclear protein known as DiGeorge Syndrome Critical Region 8 (DGCR8 or "Pasha" in invertebrates), named for its association with DiGeorge Syndrome. DGCR8 associates with the enzyme Drosha, a protein that cuts RNA, to form the Microprocessor complex. [52] [53] In this complex, DGCR8 orients the catalytic RNase III domain of Drosha to liberate hairpins from pri-miRNAs by cleaving RNA about eleven nucleotides from the hairpin base (one helical dsRNA turn into the stem). [54] [55] The product resulting has a two-nucleotide overhang at its 3' end it has 3' hydroxyl and 5' phosphate groups. It is often termed as a pre-miRNA (precursor-miRNA). Sequence motifs downstream of the pre-miRNA that are important for efficient processing have been identified. [56] [57] [58]

Pre-miRNAs that are spliced directly out of introns, bypassing the Microprocessor complex, are known as "Mirtrons." Originally thought to exist only in Drosophila and C. elegans, mirtrons have now been found in mammals. [59]

As many as 16% of pre-miRNAs may be altered through nuclear RNA editing. [60] [61] [62] Most commonly, enzymes known as adenosine deaminases acting on RNA (ADARs) catalyze adenosine to inosine (A to I) transitions. RNA editing can halt nuclear processing (for example, of pri-miR-142, leading to degradation by the ribonuclease Tudor-SN) and alter downstream processes including cytoplasmic miRNA processing and target specificity (e.g., by changing the seed region of miR-376 in the central nervous system). [60]

Nuclear export Edit

Pre-miRNA hairpins are exported from the nucleus in a process involving the nucleocytoplasmic shuttler Exportin-5. This protein, a member of the karyopherin family, recognizes a two-nucleotide overhang left by the RNase III enzyme Drosha at the 3' end of the pre-miRNA hairpin. Exportin-5-mediated transport to the cytoplasm is energy-dependent, using guanosine triphosphate (GTP) bound to the Ran protein. [63]

Cytoplasmic processing Edit

In the cytoplasm, the pre-miRNA hairpin is cleaved by the RNase III enzyme Dicer. [64] This endoribonuclease interacts with 5' and 3' ends of the hairpin [65] and cuts away the loop joining the 3' and 5' arms, yielding an imperfect miRNA:miRNA* duplex about 22 nucleotides in length. [64] Overall hairpin length and loop size influence the efficiency of Dicer processing. The imperfect nature of the miRNA:miRNA* pairing also affects cleavage. [64] [66] Some of the G-rich pre-miRNAs can potentially adopt the G-quadruplex structure as an alternative to the canonical stem-loop structure. For example, human pre-miRNA 92b adopts a G-quadruplex structure which is resistant to the Dicer mediated cleavage in the cytoplasm. [67] Although either strand of the duplex may potentially act as a functional miRNA, only one strand is usually incorporated into the RNA-induced silencing complex (RISC) where the miRNA and its mRNA target interact.

While the majority of miRNAs are located within the cell, some miRNAs, commonly known as circulating miRNAs or extracellular miRNAs, have also been found in extracellular environment, including various biological fluids and cell culture media. [68] [69]

Biogenesis in plants Edit

miRNA biogenesis in plants differs from animal biogenesis mainly in the steps of nuclear processing and export. Instead of being cleaved by two different enzymes, once inside and once outside the nucleus, both cleavages of the plant miRNA are performed by a Dicer homolog, called Dicer-like1 (DL1). DL1 is expressed only in the nucleus of plant cells, which indicates that both reactions take place inside the nucleus. Before plant miRNA:miRNA* duplexes are transported out of the nucleus, its 3' overhangs are methylated by a RNA methyltransferaseprotein called Hua-Enhancer1 (HEN1). The duplex is then transported out of the nucleus to the cytoplasm by a protein called Hasty (HST), an Exportin 5 homolog, where they disassemble and the mature miRNA is incorporated into the RISC. [70]

The mature miRNA is part of an active RNA-induced silencing complex (RISC) containing Dicer and many associated proteins. [71] RISC is also known as a microRNA ribonucleoprotein complex (miRNP) [72] A RISC with incorporated miRNA is sometimes referred to as a "miRISC."

Dicer processing of the pre-miRNA is thought to be coupled with unwinding of the duplex. Generally, only one strand is incorporated into the miRISC, selected on the basis of its thermodynamic instability and weaker base-pairing on the 5' end relative to the other strand. [73] [74] [75] The position of the stem-loop may also influence strand choice. [76] The other strand, called the passenger strand due to its lower levels in the steady state, is denoted with an asterisk (*) and is normally degraded. In some cases, both strands of the duplex are viable and become functional miRNA that target different mRNA populations. [77]

Members of the Argonaute (Ago) protein family are central to RISC function. Argonautes are needed for miRNA-induced silencing and contain two conserved RNA binding domains: a PAZ domain that can bind the single stranded 3' end of the mature miRNA and a PIWI domain that structurally resembles ribonuclease-H and functions to interact with the 5' end of the guide strand. They bind the mature miRNA and orient it for interaction with a target mRNA. Some argonautes, for example human Ago2, cleave target transcripts directly argonautes may also recruit additional proteins to achieve translational repression. [78] The human genome encodes eight argonaute proteins divided by sequence similarities into two families: AGO (with four members present in all mammalian cells and called E1F2C/hAgo in humans), and PIWI (found in the germ line and hematopoietic stem cells). [72] [78]

Additional RISC components include TRBP [human immunodeficiency virus (HIV) transactivating response RNA (TAR) binding protein], [79] PACT (protein activator of the interferon-induced protein kinase), the SMN complex, fragile X mental retardation protein (FMRP), Tudor staphylococcal nuclease-domain-containing protein (Tudor-SN), the putative DNA helicase MOV10, and the RNA recognition motif containing protein TNRC6B. [63] [80] [81]

Mode of silencing and regulatory loops Edit

Gene silencing may occur either via mRNA degradation or preventing mRNA from being translated. For example, miR16 contains a sequence complementary to the AU-rich element found in the 3'UTR of many unstable mRNAs, such as TNF alpha or GM-CSF. [82] It has been demonstrated that given complete complementarity between the miRNA and target mRNA sequence, Ago2 can cleave the mRNA and lead to direct mRNA degradation. In the absence of complementarity, silencing is achieved by preventing translation. [41] The relation of miRNA and its target mRNA can be based on the simple negative regulation of a target mRNA, but it seems that a common scenario is the use of a "coherent feed-forward loop", "mutual negative feedback loop" (also termed double negative loop) and "positive feedback/feed-forward loop". Some miRNAs work as buffers of random gene expression changes arising due to stochastic events in transcription, translation and protein stability. Such regulation is typically achieved by the virtue of negative feedback loops or incoherent feed-forward loop uncoupling protein output from mRNA transcription.

Turnover of mature miRNA is needed for rapid changes in miRNA expression profiles. During miRNA maturation in the cytoplasm, uptake by the Argonaute protein is thought to stabilize the guide strand, while the opposite (* or "passenger") strand is preferentially destroyed. In what has been called a "Use it or lose it" strategy, Argonaute may preferentially retain miRNAs with many targets over miRNAs with few or no targets, leading to degradation of the non-targeting molecules. [83]

Decay of mature miRNAs in Caenorhabditis elegans is mediated by the 5'-to-3' exoribonuclease XRN2, also known as Rat1p. [84] In plants, SDN (small RNA degrading nuclease) family members degrade miRNAs in the opposite (3'-to-5') direction. Similar enzymes are encoded in animal genomes, but their roles have not been described. [83]

Several miRNA modifications affect miRNA stability. As indicated by work in the model organism Arabidopsis thaliana (thale cress), mature plant miRNAs appear to be stabilized by the addition of methyl moieties at the 3' end. The 2'-O-conjugated methyl groups block the addition of uracil (U) residues by uridyltransferase enzymes, a modification that may be associated with miRNA degradation. However, uridylation may also protect some miRNAs the consequences of this modification are incompletely understood. Uridylation of some animal miRNAs has been reported. Both plant and animal miRNAs may be altered by addition of adenine (A) residues to the 3' end of the miRNA. An extra A added to the end of mammalian miR-122, a liver-enriched miRNA important in hepatitis C, stabilizes the molecule and plant miRNAs ending with an adenine residue have slower decay rates. [83]

The function of miRNAs appears to be in gene regulation. For that purpose, a miRNA is complementary to a part of one or more messenger RNAs (mRNAs). Animal miRNAs are usually complementary to a site in the 3' UTR whereas plant miRNAs are usually complementary to coding regions of mRNAs. [86] Perfect or near perfect base pairing with the target RNA promotes cleavage of the RNA. [87] This is the primary mode of plant miRNAs. [88] In animals the match-ups are imperfect.

For partially complementary microRNAs to recognise their targets, nucleotides 2–7 of the miRNA (its 'seed region' [11] [36] ) must be perfectly complementary. [89] Animal miRNAs inhibit protein translation of the target mRNA [90] (this is present but less common in plants). [88] Partially complementary microRNAs can also speed up deadenylation, causing mRNAs to be degraded sooner. [91] While degradation of miRNA-targeted mRNA is well documented, whether or not translational repression is accomplished through mRNA degradation, translational inhibition, or a combination of the two is hotly debated. Recent work on miR-430 in zebrafish, as well as on bantam-miRNA and miR-9 in Drosophila cultured cells, shows that translational repression is caused by the disruption of translation initiation, independent of mRNA deadenylation. [92] [93]

miRNAs occasionally also cause histone modification and DNA methylation of promoter sites, which affects the expression of target genes. [94] [95]

Nine mechanisms of miRNA action are described and assembled in a unified mathematical model: [85]

  • Cap-40S initiation inhibition
  • 60S Ribosomal unit joining inhibition
  • Elongation inhibition
  • Ribosome drop-off (premature termination)
  • Co-translational nascent protein degradation
  • Sequestration in P-bodies
  • mRNA decay (destabilisation)
  • mRNA cleavage
  • Transcriptional inhibition through microRNA-mediated chromatin reorganization followed by gene silencing.

It is often impossible to discern these mechanisms using experimental data about stationary reaction rates. Nevertheless, they are differentiated in dynamics and have different kinetic signatures. [85]

Unlike plant microRNAs, the animal microRNAs target diverse genes. [36] However, genes involved in functions common to all cells, such as gene expression, have relatively fewer microRNA target sites and seem to be under selection to avoid targeting by microRNAs. [96]

dsRNA can also activate gene expression, a mechanism that has been termed "small RNA-induced gene activation" or RNAa. dsRNAs targeting gene promoters can induce potent transcriptional activation of associated genes. This was demonstrated in human cells using synthetic dsRNAs termed small activating RNAs (saRNAs), [97] but has also been demonstrated for endogenous microRNA. [98]

Interactions between microRNAs and complementary sequences on genes and even pseudogenes that share sequence homology are thought to be a back channel of communication regulating expression levels between paralogous genes. Given the name "competing endogenous RNAs" (ceRNAs), these microRNAs bind to "microRNA response elements" on genes and pseudogenes and may provide another explanation for the persistence of non-coding DNA. [99]

Some researches show that mRNA cargo of exosomes may have a role in implantation, they can savage an adhesion between trophoblast and endometrium or support the adhesion by down regulating or up regulating expression of genes involved in adhesion/invasion. [100]

Moreover, miRNA as miR-183/96/182 seems to play a key role in circadian rhythm. [101]

miRNAs are well conserved in both plants and animals, and are thought to be a vital and evolutionarily ancient component of gene regulation. [102] [103] [104] [105] [106] While core components of the microRNA pathway are conserved between plants and animals, miRNA repertoires in the two kingdoms appear to have emerged independently with different primary modes of action. [107] [108]

microRNAs are useful phylogenetic markers because of their apparently low rate of evolution. [109] microRNAs' origin as a regulatory mechanism developed from previous RNAi machinery that was initially used as a defense against exogenous genetic material such as viruses. [110] Their origin may have permitted the development of morphological innovation, and by making gene expression more specific and 'fine-tunable', permitted the genesis of complex organs [111] and perhaps, ultimately, complex life. [106] Rapid bursts of morphological innovation are generally associated with a high rate of microRNA accumulation. [109] [111]

New microRNAs are created in multiple ways. Novel microRNAs can originate from the random formation of hairpins in "non-coding" sections of DNA (i.e. introns or intergene regions), but also by the duplication and modification of existing microRNAs. [112] microRNAs can also form from inverted duplications of protein-coding sequences, which allows for the creation of a foldback hairpin structure. [113] The rate of evolution (i.e. nucleotide substitution) in recently originated microRNAs is comparable to that elsewhere in the non-coding DNA, implying evolution by neutral drift however, older microRNAs have a much lower rate of change (often less than one substitution per hundred million years), [106] suggesting that once a microRNA gains a function, it undergoes purifying selection. [112] Individual regions within an miRNA gene face different evolutionary pressures, where regions that are vital for processing and function have higher levels of conservation. [114] At this point, a microRNA is rarely lost from an animal's genome, [106] although newer microRNAs (thus presumably non-functional) are frequently lost. [112] In Arabidopsis thaliana, the net flux of miRNA genes has been predicted to be between 1.2 and 3.3 genes per million years. [115] This makes them a valuable phylogenetic marker, and they are being looked upon as a possible solution to outstanding phylogenetic problems such as the relationships of arthropods. [116] On the other hand, in multiple cases microRNAs correlate poorly with phylogeny, and it is possible that their phylogenetic concordance largely reflects a limited sampling of microRNAs. [117]

microRNAs feature in the genomes of most eukaryotic organisms, from the brown algae [118] to the animals. However, the difference in how these microRNAs function and the way they are processed suggests that microRNAs arose independently in plants and animals. [119]

Focusing on the animals, the genome of Mnemiopsis leidyi [120] appears to lack recognizable microRNAs, as well as the nuclear proteins Drosha and Pasha, which are critical to canonical microRNA biogenesis. It is the only animal thus far reported to be missing Drosha. MicroRNAs play a vital role in the regulation of gene expression in all non-ctenophore animals investigated thus far except for Trichoplax adhaerens, the only known member of the phylum Placozoa. [121]

Across all species, in excess of 5000 different miRNAs had been identified by March 2010. [122] Whilst short RNA sequences (50 – hundreds of base pairs) of a broadly comparable function occur in bacteria, bacteria lack true microRNAs. [123]

While researchers focused on miRNA expression in physiological and pathological processes, various technical variables related to microRNA isolation emerged. The stability of stored miRNA samples has been questioned. [69] microRNAs degrade much more easily than mRNAs, partly due to their length, but also because of ubiquitously present RNases. This makes it necessary to cool samples on ice and use RNase-free equipment. [124]

microRNA expression can be quantified in a two-step polymerase chain reaction process of modified RT-PCR followed by quantitative PCR. Variations of this method achieve absolute or relative quantification. [125] miRNAs can also be hybridized to microarrays, slides or chips with probes to hundreds or thousands of miRNA targets, so that relative levels of miRNAs can be determined in different samples. [126] microRNAs can be both discovered and profiled by high-throughput sequencing methods (microRNA sequencing). [127] The activity of an miRNA can be experimentally inhibited using a locked nucleic acid (LNA) oligo, a Morpholino oligo [128] [129] or a 2'-O-methyl RNA oligo. [130] A specific miRNA can be silenced by a complementary antagomir. microRNA maturation can be inhibited at several points by steric-blocking oligos. [131] [132] The miRNA target site of an mRNA transcript can also be blocked by a steric-blocking oligo. [133] For the "in situ" detection of miRNA, LNA [134] or Morpholino [135] probes can be used. The locked conformation of LNA results in enhanced hybridization properties and increases sensitivity and selectivity, making it ideal for detection of short miRNA. [136]

High-throughput quantification of miRNAs is error prone, for the larger variance (compared to mRNAs) that comes with methodological problems. mRNA-expression is therefore often analyzed to check for miRNA-effects in their levels (e.g. in [137] ). Databases can be used to pair mRNA- and miRNA-data that predict miRNA-targets based on their base sequence. [138] [139] While this is usually done after miRNAs of interest have been detected (e. g. because of high expression levels), ideas for analysis tools that integrate mRNA- and miRNA-expression information have been proposed. [140] [141]

Just as miRNA is involved in the normal functioning of eukaryotic cells, so has dysregulation of miRNA been associated with disease. A manually curated, publicly available database, miR2Disease, documents known relationships between miRNA dysregulation and human disease. [142]

Inherited diseases Edit

A mutation in the seed region of miR-96 causes hereditary progressive hearing loss. [143]

A mutation in the seed region of miR-184 causes hereditary keratoconus with anterior polar cataract. [144]

92 cluster causes skeletal and growth defects. [145]

Cancer Edit

The first human disease known to be associated with miRNA deregulation was chronic lymphocytic leukemia. Many other miRNAs also have links with cancer and accordingly are sometimes referred to as "oncomirs". In malignant B cells miRNAs participate in pathways fundamental to B cell development like B-cell receptor (BCR) signalling, B-cell migration/adhesion, cell-cell interactions in immune niches and the production and class-switching of immunoglobulins. MiRNAs influence B cell maturation, generation of pre-, marginal zone, follicular, B1, plasma and memory B cells.

Another role for miRNA in cancers is to use their expression level for prognosis. In NSCLC samples, low miR-324a levels may serve as an indicator of poor survival. [146] Either high miR-185 or low miR-133b levels may correlate with metastasis and poor survival in colorectal cancer. [147]

Furthermore, specific miRNAs may be associated with certain histological subtypes of colorectal cancer. For instance, expression levels of miR-205 and miR-373 have been shown to be increased in mucinous colorectal cancers and mucin-producing Ulcerative Colitis-associated colon cancers, but not in sporadic colonic adenocarcinoma that lack mucinous components. [148] In-vitro studies suggested that miR-205 and miR-373 may functionally induce different features of mucinous-associated neoplastic progression in intestinal epithelial cells. [148]

Hepatocellular carcinoma cell proliferation may arise from miR-21 interaction with MAP2K3, a tumor repressor gene. [149] Optimal treatment for cancer involves accurately identifying patients for risk-stratified therapy. Those with a rapid response to initial treatment may benefit from truncated treatment regimens, showing the value of accurate disease response measures. Cell-free circulating miRNAs (cimiRNAs) are highly stable in blood, are overexpressed in cancer and are quantifiable within the diagnostic laboratory. In classical Hodgkin lymphoma, plasma miR-21, miR-494, and miR-1973 are promising disease response biomarkers. [150] Circulating miRNAs have the potential to assist clinical decision making and aid interpretation of positron emission tomography combined with computerized tomography. They can be performed at each consultation to assess disease response and detect relapse.

MicroRNAs have the potential to be used as tools or targets for treatment of different cancers. [151] The specific microRNA, miR-506 has been found to work as a tumor antagonist in several studies. A significant number of cervical cancer samples were found to have downregulated expression of miR-506. Additionally, miR-506 works to promote apoptosis of cervical cancer cells, through its direct target hedgehog pathway transcription factor, Gli3. [152] [153]

DNA repair and cancer Edit

Cancer is caused by the accumulation of mutations from either DNA damage or uncorrected errors in DNA replication. [154] Defects in DNA repair cause the accumulation of mutations, which can lead to cancer. [155] Several genes involved in DNA repair are regulated by microRNAs. [156]

Germ line mutations in DNA repair genes cause only 2–5% of colon cancer cases. [157] However, altered expression of microRNAs, causing DNA repair deficiencies, are frequently associated with cancers and may be an important causal factor. Among 68 sporadic colon cancers with reduced expression of the DNA mismatch repair protein MLH1, most were found to be deficient due to epigenetic methylation of the CpG island of the MLH1 gene. [158] However, up to 15% of MLH1-deficiencies in sporadic colon cancers appeared to be due to over-expression of the microRNA miR-155, which represses MLH1 expression. [159]

In 29–66% [160] [161] of glioblastomas, DNA repair is deficient due to epigenetic methylation of the MGMT gene, which reduces protein expression of MGMT. However, for 28% of glioblastomas, the MGMT protein is deficient, but the MGMT promoter is not methylated. [160] In glioblastomas without methylated MGMT promoters, the level of microRNA miR-181d is inversely correlated with protein expression of MGMT and the direct target of miR-181d is the MGMT mRNA 3'UTR (the three prime untranslated region of MGMT mRNA). [160] Thus, in 28% of glioblastomas, increased expression of miR-181d and reduced expression of DNA repair enzyme MGMT may be a causal factor.

HMGA proteins (HMGA1a, HMGA1b and HMGA2) are implicated in cancer, and expression of these proteins is regulated by microRNAs. HMGA expression is almost undetectable in differentiated adult tissues, but is elevated in many cancers. HMGA proteins are polypeptides of

100 amino acid residues characterized by a modular sequence organization. These proteins have three highly positively charged regions, termed AT hooks, that bind the minor groove of AT-rich DNA stretches in specific regions of DNA. Human neoplasias, including thyroid, prostatic, cervical, colorectal, pancreatic and ovarian carcinomas, show a strong increase of HMGA1a and HMGA1b proteins. [162] Transgenic mice with HMGA1 targeted to lymphoid cells develop aggressive lymphoma, showing that high HMGA1 expression is associated with cancers and that HMGA1 can act as an oncogene. [163] HMGA2 protein specifically targets the promoter of ERCC1, thus reducing expression of this DNA repair gene. [164] ERCC1 protein expression was deficient in 100% of 47 evaluated colon cancers (though the extent to which HGMA2 was involved is not known). [165]

Single Nucleotide polymorphisms (SNPs) can alter the binding of miRNAs on 3'UTRs for example the case of hsa-mir181a and hsa-mir181b on the CDON tumor suppressor gene. [166]

Heart disease Edit

The global role of miRNA function in the heart has been addressed by conditionally inhibiting miRNA maturation in the murine heart. This revealed that miRNAs play an essential role during its development. [167] [168] miRNA expression profiling studies demonstrate that expression levels of specific miRNAs change in diseased human hearts, pointing to their involvement in cardiomyopathies. [169] [170] [171] Furthermore, animal studies on specific miRNAs identified distinct roles for miRNAs both during heart development and under pathological conditions, including the regulation of key factors important for cardiogenesis, the hypertrophic growth response and cardiac conductance. [168] [172] [173] [174] [175] [176] Another role for miRNA in cardiovascular diseases is to use their expression levels for diagnosis, prognosis or risk stratification. [177] miRNA's in animal models have also been linked to cholesterol metabolism and regulation.

MiRNA-712 Edit

Murine microRNA-712 is a potential biomarker (i.e. predictor) for atherosclerosis, a cardiovascular disease of the arterial wall associated with lipid retention and inflammation. [178] Non-laminar blood flow also correlates with development of atherosclerosis as mechanosenors of endothelial cells respond to the shear force of disturbed flow (d-flow). [179] A number of pro-atherogenic genes including matrix metalloproteinases (MMPs) are upregulated by d-flow, [179] mediating pro-inflammatory and pro-angiogenic signals. These findings were observed in ligated carotid arteries of mice to mimic the effects of d-flow. Within 24 hours, pre-existing immature miR-712 formed mature miR-712 suggesting that miR-712 is flow-sensitive. [179] Coinciding with these results, miR-712 is also upregulated in endothelial cells exposed to naturally occurring d-flow in the greater curvature of the aortic arch. [179]

Origin Edit

Pre-mRNA sequence of miR-712 is generated from the murine ribosomal RN45s gene at the internal transcribed spacer region 2 (ITS2). [179] XRN1 is an exonuclease that degrades the ITS2 region during processing of RN45s. [179] Reduction of XRN1 under d-flow conditions therefore leads to the accumulation of miR-712. [179]

Mechanism Edit

MiR-712 targets tissue inhibitor of metalloproteinases 3 (TIMP3). [179] TIMPs normally regulate activity of matrix metalloproteinases (MMPs) which degrade the extracellular matrix (ECM). Arterial ECM is mainly composed of collagen and elastin fibers, providing the structural support and recoil properties of arteries. [180] These fibers play a critical role in regulation of vascular inflammation and permeability, which are important in the development of atherosclerosis. [181] Expressed by endothelial cells, TIMP3 is the only ECM-bound TIMP. [180] A decrease in TIMP3 expression results in an increase of ECM degradation in the presence of d-flow. Consistent with these findings, inhibition of pre-miR712 increases expression of TIMP3 in cells, even when exposed to turbulent flow. [179]

TIMP3 also decreases the expression of TNFα (a pro-inflammatory regulator) during turbulent flow. [179] Activity of TNFα in turbulent flow was measured by the expression of TNFα-converting enzyme (TACE) in blood. TNFα decreased if miR-712 was inhibited or TIMP3 overexpressed, [179] suggesting that miR-712 and TIMP3 regulate TACE activity in turbulent flow conditions.

Anti-miR-712 effectively suppresses d-flow-induced miR-712 expression and increases TIMP3 expression. [179] Anti-miR-712 also inhibits vascular hyperpermeability, thereby significantly reducing atherosclerosis lesion development and immune cell infiltration. [179]

Human homolog microRNA-205 Edit

The human homolog of miR-712 was found on the RN45s homolog gene, which maintains similar miRNAs to mice. [179] MiR-205 of humans share similar sequences with miR-712 of mice and is conserved across most vertebrates. [179] MiR-205 and miR-712 also share more than 50% of the cell signaling targets, including TIMP3. [179]

When tested, d-flow decreased the expression of XRN1 in humans as it did in mice endothelial cells, indicating a potentially common role of XRN1 in humans. [179]

Kidney disease Edit

Targeted deletion of Dicer in the FoxD1-derived renal progenitor cells in a murine model resulted in a complex renal phenotype including expansion of nephron progenitors, fewer renin cells, smooth muscle arterioles, progressive mesangial loss and glomerular aneurysms. [182] High throughput whole transcriptome profiling of the FoxD1-Dicer knockout mouse model revealed ectopic upregulation of pro-apoptotic gene, Bcl2L11 (Bim) and dysregulation of the p53 pathway with increase in p53 effector genes including Bax, Trp53inp1, Jun, Cdkn1a, Mmp2, and Arid3a. p53 protein levels remained unchanged, suggesting that FoxD1 stromal miRNAs directly repress p53-effector genes. Using a lineage tracing approach followed by Fluorescent-activated cell sorting, miRNA profiling of the FoxD1-derived cells not only comprehensively defined the transcriptional landscape of miRNAs that are critical for vascular development, but also identified key miRNAs that are likely to modulate the renal phenotype in its absence. These miRNAs include miRs‐10a, 18a, 19b, 24, 30c, 92a, 106a, 130a, 152, 181a, 214, 222, 302a, 370, and 381 that regulate Bcl2L11 (Bim) and miRs‐15b, 18a, 21, 30c, 92a, 106a, 125b‐5p, 145, 214, 222, 296‐5p and 302a that regulate p53-effector genes. Consistent with the profiling results, ectopic apoptosis was observed in the cellular derivatives of the FoxD1 derived progenitor lineage and reiterates the importance of renal stromal miRNAs in cellular homeostasis. [182]

Nervous system Edit

miRNAs appear to regulate the development and function of the nervous system. [183] Neural miRNAs are involved at various stages of synaptic development, including dendritogenesis (involving miR-132, miR-134 and miR-124), synapse formation [184] and synapse maturation (where miR-134 and miR-138 are thought to be involved). [185] Elimination of miRNA formation in mice by experimental silencing of Dicer has lead to pathological outcomes, such as reduced neuronal size and motor abnormalities when silenced in striatal neurons [186] and neurodegeneration when silenced in forebrain neurons. [187] Some studies find altered miRNA expression in Alzheimer's disease, [188] as well as schizophrenia, bipolar disorder, major depression and anxiety disorders. [189] [190] [191]

Stroke Edit

According to the Center for Disease Control and Prevention, Stroke is one of the leading causes of death and long-term disability in America. 87% of the cases are ischemic strokes, which results from blockage in the artery of the brain that carries oxygen-rich blood. The obstruction of the blood flow means the brain cannot receive necessary nutrients, such as oxygen and glucose, and remove wastes, such as carbon dioxide. [192] [193] miRNAs plays a role in posttranslational gene silencing by targeting genes in the pathogenesis of cerebral ischemia, such as the inflammatory, angiogenesis, and apoptotic pathway. [194]

Alcoholism Edit

The vital role of miRNAs in gene expression is significant to addiction, specifically alcoholism. [195] Chronic alcohol abuse results in persistent changes in brain function mediated in part by alterations in gene expression. [195] miRNA global regulation of many downstream genes deems significant regarding the reorganization or synaptic connections or long term neural adaptations involving the behavioral change from alcohol consumption to withdrawal and/or dependence. [196] Up to 35 different miRNAs have been found to be altered in the alcoholic post-mortem brain, all of which target genes that include the regulation of the cell cycle, apoptosis, cell adhesion, nervous system development and cell signaling. [195] Altered miRNA levels were found in the medial prefrontal cortex of alcohol-dependent mice, suggesting the role of miRNA in orchestrating translational imbalances and the creation of differentially expressed proteins within an area of the brain where complex cognitive behavior and decision making likely originate. [197]

miRNAs can be either upregulated or downregulated in response to chronic alcohol use. miR-206 expression increased in the prefrontal cortex of alcohol-dependent rats, targeting the transcription factor brain-derived neurotrophic factor (BDNF) and ultimately reducing its expression. BDNF plays a critical role in the formation and maturation of new neurons and synapses, suggesting a possible implication in synapse growth/synaptic plasticity in alcohol abusers. [198] miR-155, important in regulating alcohol-induced neuroinflammation responses, was found to be upregulated, suggesting the role of microglia and inflammatory cytokines in alcohol pathophysiology. [199] Downregulation of miR-382 was found in the nucleus accumbens, a structure in the basal forebrain significant in regulating feelings of reward that power motivational habits. miR-382 is the target for the dopamine receptor D1 (DRD1), and its overexpression results in the upregulation of DRD1 and delta fosB, a transcription factor that activates a series of transcription events in the nucleus accumbens that ultimately result in addictive behaviors. [200] Alternatively, overexpressing miR-382 resulted in attenuated drinking and the inhibition of DRD1 and delta fosB upregulation in rat models of alcoholism, demonstrating the possibility of using miRNA-targeted pharmaceuticals in treatments. [200]

Obesity Edit

miRNAs play crucial roles in the regulation of stem cell progenitors differentiating into adipocytes. [201] Studies to determine what role pluripotent stem cells play in adipogenesis, were examined in the immortalized human bone marrow-derived stromal cell line hMSC-Tert20. [202] Decreased expression of miR-155, miR-221, and miR-222, have been found during the adipogenic programming of both immortalized and primary hMSCs, suggesting that they act as negative regulators of differentiation. Conversely, ectopic expression of the miRNAs 155, 221, and 222 significantly inhibited adipogenesis and repressed induction of the master regulators PPARγ and CCAAT/enhancer-binding protein alpha (CEBPA). [203] This paves the way for possible genetic obesity treatments.

Another class of miRNAs that regulate insulin resistance, obesity, and diabetes, is the let-7 family. Let-7 accumulates in human tissues during the course of aging. [204] When let-7 was ectopically overexpressed to mimic accelerated aging, mice became insulin-resistant, and thus more prone to high fat diet-induced obesity and diabetes. [205] In contrast when let-7 was inhibited by injections of let-7-specific antagomirs, mice become more insulin-sensitive and remarkably resistant to high fat diet-induced obesity and diabetes. Not only could let-7 inhibition prevent obesity and diabetes, it could also reverse and cure the condition. [206] These experimental findings suggest that let-7 inhibition could represent a new therapy for obesity and type 2 diabetes.

Hemostasis Edit

miRNAs also play crucial roles in the regulation of complex enzymatic cascades including the hemostatic blood coagulation system. [207] Large scale studies of functional miRNA targeting have recently uncovered rationale therapeutic targets in the hemostatic system. [208] [209]

When the human genome project mapped its first chromosome in 1999, it was predicted the genome would contain over 100,000 protein coding genes. However, only around 20,000 were eventually identified. [210] Since then, the advent of bioinformatics approaches combined with genome tiling studies examining the transcriptome, [211] systematic sequencing of full length cDNA libraries [212] and experimental validation [213] (including the creation of miRNA derived antisense oligonucleotides called antagomirs) have revealed that many transcripts are non-protein-coding RNA, including several snoRNAs and miRNAs. [214]

Viral microRNAs play an important role in the regulation of gene expression of viral and/or host genes to benefit the virus. Hence, miRNAs play a key role in host–virus interactions and pathogenesis of viral diseases. [215] [216] The expression of transcription activators by human herpesvirus-6 DNA is believed to be regulated by viral miRNA. [217]

miRNAs can bind to target messenger RNA (mRNA) transcripts of protein-coding genes and negatively control their translation or cause mRNA degradation. It is of key importance to identify the miRNA targets accurately. [218] A comparison of the predictive performance of eighteen in silico algorithms is available. [219] Large scale studies of functional miRNA targeting suggest that many functional miRNAs can be missed by target prediction algorithms. [208]


Prescription RNA

It’s champagne for everybody. Phil Zamore pops the cork from a bottle of Montaudon, drenching the brand-new carpet. Everyone in his lab fills a glass to toast the boss. “Unexpected good news,” he explains. Zamore, a biochemist at the University of Massachusetts Medical School in Worcester, has just received a national award worth $1 million over five years. “The budget of the lab just tripled.”

Zamore is understandably giddy, and it’s not just about the money. Zamore’s field, RNA interference, or RNAi, is only a few years old, but it has taken the world of biology by storm. “RNAi is the most exciting insight in biology in the past decade or two,” says Nobel laureate Phillip Sharp, a biologist at MIT. And Zamore’s lab is one of a handful moving the field forward at a dizzying pace. “I think everybody who works in the field feels a bit breathless from the progress,” Zamore says.

This story was part of our December 2002 issue

The sense of excitement shared by Zamore, Sharp, and other researchers is well-founded. For decades, researchers thought RNA was merely DNA’s messenger, slavishly delivering DNA’s protein blueprints. But it now appears that tiny double strands of RNA, introduced into lab-grown cells or animals, can quickly and efficiently turn off any given gene.

The implications are breathtaking, because living organisms are largely defined by the exquisitely orchestrated switching on and off of genes. Biologists, until now, have only been able to mimic this switching process in a slow, ponderous, and indirect way. But the ease with which RNAi can turn off genes, researchers say, seems almost mystical. Laboratory techniques using RNAi are already biologists’ methods of choice for discovering the functions of particular genes. And it promises a new way to treat disease directly by shutting down key genes involved in various ailments. Already, at least eight companies-including one founded by Zamore, Sharp, and colleagues-are working on RNAi therapies for everything from viral diseases to cancer.

“The Holy Grail is to develop all this into drugs,” says Zamore. “To be able to give you a small interfering RNA that would shut off expression of your high-cholesterol gene. That would lower the level of hepatitis C infecting your liver. Or maybe, I think in perhaps the biggest pie-in-the-sky application, that would hone in on a gene specific to tumor cells and kill the tumor.”

How soon this might happen is anybody’s guess. RNA interference burst into the consciousness of the scientific world at the annual meeting of the RNA Society in Banff, Alberta, in May 2001. There, Sayda Elbashir, a postdoc in the lab of biochemist Thomas Tuschl at the Max Planck Institute for Biophysical Chemistry in Gttingen, Germany, stunned his listeners with the news that tiny double-stranded RNA fragments quickly, easily, and specifically turned off genes in human cells, a role researchers had never before seen RNA play.

“Most of the audience was just sitting there saying to themselves, Science has just changed,’” recalls University of Michigan biochemist David Engelke. “The only thing that prevented pandemonium was that we’d been promised this sort of thing before.” Skeptical, Engelke waited a few months. “Then these reports started to trickle in: Gee, this really works!’”

The RNA Surprise

Until recently, the rather unglamorous role biologists had attributed to RNA was that of a passive messenger, delivering genetic information from DNA to the protein-making machinery of the cell. In this process, the DNA code of a gene is transcribed into an RNA copy, which the cellular machinery translates into a protein. In RNA interference, short bits of RNA block the process by destroying the message en route. The double-stranded RNA fragments lead cutting enzymes to the RNA that carries the genetic message. The messenger RNA is then chopped up and marked for destruction: the gene’s message is effectively “silenced.”

Biologists have known for years that single-stranded RNA molecules designed to pair with a messenger RNA could shut down protein production, but this artificial process is unreliable even in the lab. Nature, though, does regulate genes using RNA, specifically double-stranded molecules.

The first hints of the phenomenon appeared back in 1990, but at the time, researchers didn’t connect what they had observed with RNA. That year, plant biologist Rich Jorgensen, then at DNA Plant Technology in Oakland, CA, was trying to make purple petunias a deeper shade of purple. He inserted a new, supercharged copy of the gene that controls production of purple pigment. To his surprise, he got white petunias. Jorgensen recognized the importance of this paradoxical effect, but he could not explain why adding more of a gene had turned that gene off.

The next clue came in 1995, when geneticists at Cornell University cloned a gene in the microscopic soil worm C. elegans. To verify their discovery, they used a standard lab method to turn the gene off: they added a single strand of RNA that matched the messenger RNA. This complementary strand bound to the messenger, stopping it from being translated into a protein. Unexpectedly, a noncomplementary single strand of RNA they were using as an experimental control and which should have done nothing, also shut down the gene.

In 1998 biochemist Andrew Fire, then at the Carnegie Institution of Washington, and geneticist Craig Mello, at the University of Massachusetts Medical School, solved the mystery. Injecting complementary single strands of RNA into worms, they got an astonishingly potent silencing effect when the two strands combined. After demonstrating that double-stranded RNA was the real silencing agent, Fire and Mello coined the term “RNA interference,” and a new field was born. In retrospect, Jorgensen’s supercharged purple genes yielded double-stranded RNAs that had the same effect on the native purple genes, essentially shutting them off.

The double-stranded RNA seemed to provide a more stable and reliable means for shutting off specific genes than did the single strands, and labs that were studying organisms including plants, worms, and flies eagerly adopted the new method. RNA interference didn’t work in mammals, though: the immune system destroys cells that contain double-stranded RNA to defend against RNA viruses like those that cause hepatitis A and C. Then came Tuschl and Elbashir’s revelation in Banff that very short RNA segments, which they dubbed “small interfering RNA,” did work in human cells. At that point, says Sharp, “the whole field took off.”

Silent Treatment

Now investigators are looking for ways to turn this powerful new role for RNA into corporate profits. Virtually all drug companies already use RNA interference as a tool for drug discovery. One of the most popular strategies for finding new drug targets involves knocking out-or disabling-genes one by one to see what happens. If, for example, a diseased animal can be cured by knocking out a particular gene, that gene’s protein could make a good drug target. Using small interfering RNAs, it turns out, can radically speed this process. Instead of spending months or years to engineer a knockout, researchers use the RNAs to specifically and rapidly shut off a gene. They can also observe whether turning off the protein-as a drug would-causes side effects. The process takes place “in a matter of days, instead of a year,” says Christophe Echeverri, CEO of Cenix BioScience, a biotech company in Dresden, Germany.

In the ultimate application, small interfering RNAs might themselves be drugs: rather than blocking a particular protein, as standard drugs do, RNAi would prevent the protein from ever being made. Last June, MIT’s Sharp showed that such RNAs, targeted to key viral and human genes, could stop HIV infection in cells grown in the lab. In one experiment, the researchers mixed HIV-infected cells with small interfering RNAs targeted to viral genes. The RNAs halted viral reproduction. Sharp’s group also mixed uninfected cells with small interfering RNAs targeted to CD4, a protein on the surface of cells through which HIV gains entry. The researchers showed that the RNAs did decrease production of CD4. Two and a half days later, they exposed RNA-treated cells and untreated cells to HIV. The virus infected four times as many untreated cells.

Despite the encouraging results, for the time being RNAi drugs are still in the dream stage, says Sharp. But Sharp considered the early promise tantalizing enough to cofound-with Zamore, Tuschl, and two other scientists-Alnylam Pharmaceuticals in Cambridge, MA, to develop such drugs. The company was barely off the ground when it secured $17 million in venture capital funding last July.

Making RNAi drugs, though, won’t be easy. For one thing, no one has found methods suitable for administering the RNAs to humans. “There’s a delivery problem. It’s as simple as that,” says Harvard University chemist Stuart Schreiber. “Getting nucleic acids to their target tissues [is] an unsolved problem in medicine.” RNAi therapy is essentially gene therapy, Schreiber says, and it will face the same problems-inefficiency, ineffectiveness, and immunological side effects-that have stalled that field since 1999, when Jesse Gelsinger died during a gene therapy trial at the University of Pennsylvania. Doctors there used modified viruses as delivery vehicles, or “vectors,” to shuttle DNA into the teenager’s cells. Gelsinger’s immune system responded massively-and fatally.

Sharp says the hope is that small interfering RNA might not need vectors to reach its target, thus avoiding most of the pitfalls associated with DNA-based gene therapy. But that scenario is far from certain. “Can you modify RNAs to make them more stable [and] to make them be taken up more efficiently by cells?” Sharp asks. “We don’t know.”

Making Sense

Recent biomedical history doesn’t help settle the uncertainty. In fact, this isn’t the first time scientists have tried to make a drug based on silencing RNA. Single-stranded “antisense” RNA or DNA can also shut down genes-and doesn’t need a vector. Inside the cell, an antisense molecule finds its complementary messenger RNA and, like two sides of a zipper, they bind tightly, preventing the messenger RNA from going through the protein-making machinery of the cell. The result, in theory at least, is gene shutdown.

Antisense, though, has so far been a disappointment as the basis for new drugs. After more than a decade of intense developmental work, only one antisense drug-Isis Pharmaceuticals’ Vitravene, for the treatment of certain rare eye infections in AIDS patients-has won Food and Drug Administration approval. The first generation of antisense drugs, which were tested in the early 1990s, rapidly degraded in the body, were hard to get into cells, often failed to find their target, and caused severe side effects. More stable antisense drugs are now being tested in humans.

Can RNAi do better than antisense? Not anytime soon, predicts Frank Bennett, vice president for antisense research at Isis. “If you compare RNAi to the current version of antisense, there really is no advantage,” he says. “[Small interfering] RNA technology is really in its infancy. It’s somewhat equivalent to where antisense was 10 years ago, when we were just beginning to do experiments in animals.”

But RNAi people see their technology as fundamentally different from antisense. “The big advantage here of RNAi over antisense is that, lo and behold, this actually really works,” says Cenix CEO Echeverri. RNAi, he says, is far more potent and reliable than antisense. “Antisense projects were typically seen as suicide projects,” he says. “You could spend a lot of time getting it to work, and it would never work. You’d be left with nothing to show.” RNAi’s greater potency, Echeverri believes, should yield better therapies. And because less drug will be needed to silence a gene, there should be fewer side effects.

People have been struggling with antisense, and here’s a technology that comes along that really works,” agrees Jon Wolff, chief scientific officer of Mirus, an RNA therapeutics company in Madison, WI. “Antisense is hard to reproduce, but RNAi is something that works right out of the barrel.”

But could RNAi be just another overhyped technology? “The proof is in the pudding,” says Echeverri. “Over the last two, three years, RNAi has just completely taken over. Everyone is turning to it in every organism they’re trying it. And it wouldn’t be this popular if it weren’t successful.”

Silencing Doubts

No one has yet tried RNAi in humans, but one company is close: Ribopharma, a biotech startup in Kulmbach, Germany. More than a year before Tuschl’s group stunned the scientific community with its news, Ribopharma’s founders, former Bayreuth University lecturers Roland Kreutzer and Stefan Limmer, discovered that small RNAs worked in mammalian cells. Or so Kreutzer and Limmer claim. They have never published their data.

Kreutzer and Limmer reasoned that it was physically impossible for the very long RNAs, such as those used by Fire and Mello, to bind all at once to their target RNAs. Only short segments would stick. So they tried silencing mammalian genes using RNAs short enough to evade the fatal immune response. “It wasgambling,” says Limmer. “And it turned out that it really works.” The researchers filed a patent application, quit their teaching jobs, and in June 2000 founded Ribopharma.

Ribopharma’s principals are planning to begin human trials next year, probably starting with tests of small interfering RNAs in the treatment of malignant melanoma and pancreatic cancer. Kreutzer and Limmer say their RNA constructs are stable enough to work without vectors and can be injected directly into the site of a tumor or into the bloodstream. The company has raised more than $18 million. But because Ribopharma has yet to publish its results, it’s difficult to evaluate its claims, say other RNA researchers. “They’ve been doing some things,” says MIT’s Sharp, “quite nicely….[But] it’s a long road.”

How long? Attitudes range from Ribopharma’s sanguine assurances to strong pessimism. David Beach, president of RNAi startup Genetica in Cambridge, MA, points to antisense’s decade-plus odyssey. “I don’t want to sit and argue deploying RNAi in a therapeutic mode would be any simpler,” he says.

What is far clearer is that RNAi is forcing biologists to rethink RNA’s role. In the last few years, researchers have found hundreds of genes that code for small RNA molecules, dubbed “microRNAs,” in organisms ranging from plants and worms to humans. Like their small interfering RNA cousins, microRNAs appear to silence genes, but their role in biology is mostly unknown. “Many of them have been very highly conserved during the course of evolution [so] they must be doing something important,” says MIT biologist David Bartel. Meanwhile, the realization that RNAi is a natural-and probably fundamental-process in plants and animals has helped make it one of the most exciting mysteries in today’s biology.

“Tiny RNA genes may be the biological equivalent of dark matter-all around us but almost escaping detection,” wrote Gary Ruvkun, a Harvard Medical School molecular biologist, in 2001 in the journal Science. What are these mysterious genes doing? “I suspect what we’re looking at is a very ancient method of controlling gene expression,” says Zamore.

If microRNAs are switches that decide whether stem cells become neurons or muscle, or whether cancer cells grow or die, then RNA interference is a lot more important than anyone imagined just a few years ago. “We simply stumbled upon a whole new branch of molecular biology that we didn’t know about before,” says Michigan’s Engelke.

To the optimists, these breakthroughs portend the quick development of effective drugs. And even biomedical researchers made cynical by extravagant claims for magical cures think RNAi just may be the real thing. Last year, when RNAi first worked in human cells, “everyone woke up and said, I wonder if this is the silver bullet?’” says Engelke. “And it might be. It might be.”

Companies Developing RNA Interference COMPANY PRIMARY RNAi FOCUS Alnylam Pharmaceuticals
(Cambridge, MA)
Therapeutics Benitec
(Brisbane, Australia)
Intellectual property for genomics and therapeutics Cenix BioScience
(Dresden, Germany)
Drug target identification and therapeutics for cancer Devgen
(Ghent, Belgium)
Drug target identification and therapeutics for diabetes, depression, and Parkinson’s disease Genetica
(Cambridge, MA)
Drug target identification for cancer Mirus
(Madison, WI)
Therapeutics, using long double-stranded RNA Ribopharma
(Kulmbach, Germany)
Therapeutics for cancer and hepatitis C


What is Antisense strand

The complementary strand to the sense strand in the DNA double-stranded is referred to as the antisense strand, which runs from 3’ direction to 5’ direction. The antisense strand is considered as in the negative sense. It serves as the template for the mRNA synthesis, transcription. Therefore, the antisense strand is responsible for the amino acid sequence of the translated polynucleotide. The antisense strand contains anti-codons, which are the nucleotide triplets found in tRNAs. The anti-codon is complementary to codon. During the transcription, RNA polymerase, which is the enzyme involving in the transcription add complementary nucleotides to the template strand. The synthesizing mRNA is temporarily attached to the template strand by the formation of hydrogen bonds with their complementary bases in the template strand. RNA polymerase adds uracil as the complementary base to adenine instead of thymine.

The sense and antisense strands play a critical role in RNA interference inside the cell. RNA interference is a natural mechanism, which is used by cells in order to regulate the gene expression. During RNA interference, gene expression is knocked down by the production of an antisense DNA oligonucleotide strand, which can be complementarily base paired with the transcribed mRNA strand of a particular gene. The forming double-stranded RNA-DNA structure is cleaved off by Dicer protein complexes, clearing off the mRNA from the system. The mechanism in RNA interference is shown in figure 2.

Figure 2: RNA Interference Mechanism


MicroFunctions

miRNAs function in a broad range of biological processes in plants and animals (Kidner and Martienssen,2005 Alvarez-Garcia and Miska,2005). The first insight into their function came from phenotypic studies of mutations that disrupt core components of the miRNA pathway. dicer mutants show diverse developmental defects, including abnormal embryogenesis in Arabidopsis, delayed germ-line stem-cell (GSC)division in Drosophila, germ-line defects in C. elegans,abnormal embryonic morphogenesis in zebrafish and stem-cell differentiation defects in mice (Knight and Bass,2001 Park et al.,2002 Bernstein et al.,2003 Wienholds et al.,2003 Giraldez et al.,2005 Hatfield et al.,2005). Similarly, the disruption of Argonaute function causes widespread developmental defects, such as defective stem-cell maintenance and failure to form axillary meristem in an Arabidopsis mutant for PINHEAD/ZWILLE (PNH/ZLL) or ARGONAUTE 1 (AGO1), a stem-cell self-renewal defect in Drosophila piwi mutants, and defective early development in C. elegans alg-1 and alg-2 mutants(Bohmert et al., 1998 Cox et al., 1998 Moussian et al., 1998 Grishok et al., 2001). Arabidopsis plants mutant for ZIPPY (ZIP), an Argonaute gene, and HASTY (HST), which encodes the miRNA export receptor, exhibit a precocious vegetative phenotype and produce abnormal flowers (Peragine et al.,2004). Overall, these phenotypes suggest that at least a subset of miRNAs play important roles in early development.


MicroRNAs—Basic Biology and Therapeutic Potential

A. Katrina Loomis , Graham J. Brock , in Annual Reports in Medicinal Chemistry , 2011

1.1 Background

MicroRNAs were originally discovered in Caenorhadbitis elegans [1] , and due to their high sequence conservation, their subsequent discovery in many other organisms including mammals was facilitated. MicroRNA genes are frequently located in intronic regions of protein-coding genes but may also be found in intergenic regions of the genome and can occur singly or in clusters. When microRNAs are located in introns, their expression is thought to be co-regulated with that of their host gene. MicroRNA genes are transcribed by RNA polymerase II (RNA Pol II) to form primary microRNAs (pri-miRNAs) which are then capped and polyadenylated [2] . These primary transcripts are subsequently processed into ∼ 70 nt precursor microRNAs (pre-miRNAs) by Drosha, an RNase III endonuclease [3] and exported from the nucleus by Exportin-5 [4] (see Figure 1 ). Significantly, the ∼ 70 nt pre-microRNA folds into a distinct hairpin conformation, and many microRNA sequences are highly conserved across multiple species. Consequently, to identify other putative microRNAs, many computational methods utilize algorithms to scan the genome for sequences capable of forming these characteristic hairpin structures and to identify sequences that are highly similar if not identical to microRNA sequences from other species. As of 2011, the microRNA registry contained predictions of over 15,000 microRNAs, over a thousand of which are in the human genome [5] . Experimental methods are needed to confirm the existence of these predicted microRNAs. As with some protein-coding genes, some microRNAs belong to large microRNA families with members differing in sequence by 1 or 2 nt ( Table 1 ).

Figure 1 . Schematic outline of the main steps in microRNA biogenesis. MicroRNAs are initially synthesized as pri-microRNA transcripts by RNA Pol II in the nucleus. Processing by Drosha results in ∼ 70 nt hairpin pre-microRNA molecules which are exported to the cytoplasm by Exportin 5. Dicer processing leads to the formation of mature microRNAs which are then loaded into the RISC. The passenger strand microRNA is cleaved and degraded, while the guide strand microRNA is retained and used by RISC to identify its target mRNA. Regulation of gene expression is through either translational repression or an mRNA cleavage/degradation mechanism.

Table 1 . The hsa-let-7 family of microRNAs showing high sequence similarity

MicroRNASequence 5′ to 3′
hsa-let-7aUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dAGAGGUAGUAGGUUGCAUAGUU
hsa-let-7eUGAGGUAGGAGGUUGUAUAGUU
hsa-let-7fUGAGGUAGUAGAUUGUAUAGUU
hsa-let-7gUGAGGUAGUAGUUUGUACAGUU
hsa-let-7iUGAGGUAGUAGUUUGUGCUGUU

The seed region (nts 2–7) of this microRNA family is underlined and nucleotides that differ from hsa-let-7a are shown in bold.

Once in the cytoplasm, the double-stranded pre-microRNAs are processed by Dicer, another member of the RNase III endonuclease family, into mature ∼ 22 nt microRNAs [3] ( Figure 1 ). This mature double-stranded microRNA species is made up of the guide strand (designated as miR) and its complementary passenger strand (designated as miR*). The regulation of mRNAs by a mature microRNA requires incorporation into the RNA-induced silencing complex (RISC), which comprises multiple proteins including Argonaute, Dicer, and TAR RNA binding proteins (TRBP) (reviewed in Ref. [6] ). Following incorporation, the passenger microRNA strand (miR*) is degraded and released from the RISC. The relative thermodynamic stability of each end of the double-stranded microRNA species plays a large role in determining which strand becomes the guide strand and is retained, and which strand is degraded [7,8] . The recognition of mRNA targets by the RISC occurs through the guide strand microRNA and is thought to be based on the perfect (or almost perfect) sequence complementarity to the “seed region,” defined as nucleotides 2–7 at the 5′end of the microRNA. Previously, suppression of gene expression was thought to result either from cleavage of the targeted mRNA followed by its degradation or from translational repression of the target [9–11] . For the cleavage/degradation mechanism to occur, extensive complementarity between the microRNA and its target is required, whereas translational repression is facilitated primarily through complementarity with the seed region. As the majority of microRNAs do not have extensive matches with their predicted mRNA targets, this suggests translational repression as the main mode of action of microRNAs. However, it has recently been reported that degradation of the mRNA target frequently follows translational repression [12] .

The limited complementarity between a miRNA and its target mRNAs (with complementarity focusing on the seed region) has hindered the identification of mRNA targets of microRNA action. Consequently, the function of large numbers of microRNAs remains unknown. Nonetheless, current understanding of their basic mechanism of action has established them as an important class of regulatory molecules, adding a new level of eukaryotic gene regulation at the posttranscriptional level [13,14] . Furthermore, microRNA expression patterns may be altered during the progression of many diseases. Therefore, their potential utility as biomarkers in human diseases has been an area of intense investigation, and a database of reported microRNA disease associations is available [15] . To date, studies of altered microRNA expression patterns have mainly focused on oncology, but recent reports have indicated that microRNA expression can be disrupted in other human diseases as well. Questions surrounding the feasibility of using such molecules as biomarkers relate to the technical challenges inherent in discriminating between such highly similar sequences. Despite these challenges, microRNA signatures have proven to be more robust prognostic markers in oncology than mRNA signatures [16,17] .


Validation of Synthetic Pre-miR Design

The most effective miR-33 sequence was tested for strand specificity in several different cell lines to ensure that the observed effect was not cell type specific. The let-7b miRNA was not used because all but HepG2 cells express high levels of let-7b that would mask the effects of the synthetic miRNA. The miR-33 off-strand had essentially no activity in any of the cell types that were used (Figure 2). Additionally, the reduction in the miRNA-specific reporters by the miR-33 molecule mirrored the transfection efficiencies of the cell types tested.

To confirm that the best design could be successfully applied to other miRNAs, siRNA and enhanced design synthetic miRNAs (the Pre-miR design) were prepared for miR-1, miR-10, and miR-124. HeLa cells were transfected with the synthetic miRNAs at a final concentration of 3 and 10 nM, respectively. The expression of co-transfected reporters for each of the miRNAs was monitored 24 hours post-transfection. As was observed for miR-33 and let-7b, the Pre-miR design miRNAs, referred to as Pre-miR miRNA Precursor Molecules, were significantly more active than the corresponding siRNA-like synthetic miRNAs (Figure 3).

Ultimately, the synthetic miRNAs must function in cells in a manner that is consistent with naturally occurring miRNAs. Cells were transfected with four different Pre-miR miRNAs and the expression of genes that are known or predicted to be regulated by the four miRNAs was measured. The Pre-miR miRNAs reduced the expression of the natural target genes by 50-80% (Figure 4).


References:

Simone R, Javad F, Emmett W, Wilkins OG, Almeida FL, Barahona-Torres N, Zareba-Paslawska J, Ehteramyan M, Zuccotti P, Modelska A, Siva K, Virdi GS, Mitchell JS, Harley J, Kay VA, Hondhamuni G, Trabzuni D, Ryten M, Wray S, Preza E, Kia DA, Pittman A, Ferrari R, Manzoni C, Lees A, Hardy JA, Denti MA, Quattrone A, Patani R, Svenningsson P, Warner TT, Plagnol V, Ule J, de Silva R. MIR-NATs repress MAPT translation and aid proteostasis in neurodegeneration. Nature . 2021 Jun594(7861):117-123. Epub 2021 May 19 PubMed.


Watch the video: miRNA Pathway Music Video (May 2022).