Information

Does adding antibiotic after 5-10 mins of innoculation affect the protein yield or growth?

Does adding antibiotic after 5-10 mins of innoculation affect the protein yield or growth?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

I've asked a lab colleague the same question. She said, it would loosen the bacterial cells in the LB medium and plasmids would come out. Is that true? and why?


That is not true. If you had forgotten to add the antibiotic before inoculation then you can add it before the bacteria starts growing. Make sure you add it when the bacteria is still in lag phase. If you add it later then it won't be effective as some non-resistant (non-transformed) bacteria would have already expanded their population. Ampicillin and kanamycin are best effective when the bacteria are growing. Even though these antibiotics are considered bacteriocidal, you would end up having unnecessary biomass in your culture.

So 5min delay for E.coli is not an issue. (I think this happens to all of us: forgetting to add antibiotic).


The protocols listed below can be used for growing and maintaining yeasts in liquid and solid media

Yeast Growth in YPD Broth

  1. Suspend 50g of the Product (Product No. Y1375) in 1L of distilled water.
  2. Autoclave for 15 minutes at 121 °C.
  3. Inoculate yeast cultures (sourced from yeast broths/plates) in detergent-free tubes/flasks containing the prepared liquid medium, see steps 1 and 2 (the medium should not be more than a third of culture tube volume or a fifth of the total flask volume).
  4. Vortex the contents briefly to disperse cells.
  5. Grow the culture in a shaking incubator at 300 rpm (for flasks) or 350 rpm (for culture tubes).

Yeast Growth on YPD Agar

  1. Suspend 65g of the product (Product No. Y1500) in 1L of distilled water.
  2. Heat to boiling while stirring to dissolve all ingredients completely.
  3. Autoclave for 15 minutes at 121 °C.
  4. Pour around 25-30 mL of the agar medium on to sterile plates and let it set in a laminar flow chamber.
  5. Streak (yeast obtained from YPD plate)/spread (yeast sourced from broth cultures) cells on the agar plates and incubate at 30 °C.

Note: Single yeast colonies may be observed after around 24 hours, but incubations over 48 hours are needed before they can be used for replica plating purposes. The growth rate of yeast cultures using synthetic drop-out medium supplements is


INTRODUCTION

This article provides a general workflow and describes key issues to be considered in making recombinant selenoproteins in Escherichia coli. Selenocysteine (Sec, U), discovered after the genetic code (containing the 20 canonical amino acids) was initially deciphered, was found to recode a stop codon in specific instances (Labunskyy, Hatfield, & Gladyshev, 2014 Yoshizawa & Böck, 2009 ). Sec has been found in proteins throughout all three domains of life. It has a unique and complex translation pathway that makes its site-specific incorporation difficult, unlike the process for canonical amino acids (Fig. 1). The strategy described below reduces the complexity of the natural Sec incorporation pathway, yielding a system applicable to any protein of interest (details are discussed in the Background Information).


Results

PsINV has a rust fungi-specific structure

The full-length ORF of PsINV was cloned from the cDNA of CYR32 urediospore germlings with specific primers. The ORF of PsINV comprised 2310 bp, encoding a protein of 769 amino acids. Sequence data for PsINV have been deposited at GenBank under accession number KX230123. The molecular weight of the predicted protein was 86.66 kDa, and the theoretical pI of the predicted protein was 6.37. By comparing the nucleotide sequences of PsINV from seven Pst isolates whose genomes have been publicly available on the NCBI genome database, it was shown that this gene was highly conserved in all Pst races with no more than three nucleotide substitutions (Fig. S1.).

The 769 amino acids sequence of PsINV was used as a query to search protein databases. Invertases from both nonpathogenic fungi and pathogenic fungi showing high similarity to PsINV were identified. A phylogenetic tree was reconstructed with a total of 56 fungal and four wheat invertases. The phylogenetic analysis revealed that PsINV clustered with other rust invertases in one clade (Fig. 1a). The results of domain prediction analysis showed that PsINV has two glycosyl hydrolase family 32 N-terminal domains, named N1 and N2, and one glycosyl hydrolase family 32 C-terminal domain, named C domain, according to the Pfam protein families database. The N domain was the combination of two (N1 and N2) domains. In contrast to invertases of yeast and some other pathogenic fungi, this has one N-terminal domain and one C-terminal domain (Fig. 1b). P hyre 2 was used to construct a 3D molecular model of PsINV by homology modeling methods (Kelley et al., 2015 ), and different colors were used to label the different domains with PyMOL (Fig. 1c).

Functional validation of the signal peptide of PsINV

To determine whether PsINV is secreted into the host tissues, several bioinformatic prediction websites were used to clarify whether PsINV has a signal peptide. Although no signal peptide was identified by SignalP 4.1, Phobius showed there was a signal peptide composed of 60 amino acids encoded by the first 180 bp of PsINV. The signal peptide of PsINV was cloned into the pSUC2 vector for further verification. With both positive controls and negative controls, the transformed yeast strains were inoculated on both CMD-W medium and YPRAA medium for functional testing. It was shown that the signal peptide of PsINV had the same effect on secretion of SUC2 as well-known signal peptides from fungi, including Pst (Fig. 2) (Gu et al., 2011 ). This result confirmed the presence of a functional signal peptide in PsINV.

Transcript profiles of PsINV

To gain insight into a possible function of PsINV during Pst infection, we analyzed transcript abundance of PsINV at different time points during the infection process by qRT-PCR. As changes in sugar levels were observed in both compatible and incompatible systems in a previous report (Chang et al., 2013 ), transcript profiles of PsINV were analyzed in the two systems. In incompatible systems, Pst could grow sustainably with growth limitation before obvious necrosis appeared on infected leaves 13–15 dpi (Fig. S2). Samples were collected for both compatible and incompatible systems up to 264 hpi when new spores are produced in the compatible systems. With quantification of PsINV expression profiles in different compatible and incompatible systems inoculated with different Pst races, all results show a similar expression pattern. In compatible systems, the expression of PsINV is induced at the beginning of the infection process. At 72–168 hpi, transcript levels increased sharply as secondary hyphae extended and numerous haustoria formed (Fig. 3). Expression then decreased to very low levels. In incompatible systems, a similar expression pattern as in compatible systems was observed before 168 hpi, but the decline of this expression was much slower than that in the compatible systems after 168 hpi. The abundance of PsINV transcripts during the infection process suggests that PsINV plays an important role in Pst infection.

Heterologous expression of PsINV

To characterize PsINV in S. cerevisiae, the complete ORF was cloned into S. cerevisiae expression vector pDR195. Transformants of S. cerevisiae strain SEY2102 were obtained by transformation with either the empty vector pDR195 or the recombinant plasmid pDR195::PsINV. Both types of transformants show no difference in growth on SC medium with glucose as carbon source (Sherman, 1991 ). However, on SC medium with sucrose as sole carbon source, pDR195 transformants could not grow at all, but pDR195::PsINV transformants could complement the invertase-negative phenotype of this strain (Fig. 4a). This result confirms that PsINV acts as an invertase in vivo.

To confirm that PsINV acts as a true invertase in vitro, vector pPICZαA::PsINV was constructed for expression of PsINV in P. pastoris. With an alpha factor signal added to the N terminus of PsINV, the mature protein is secreted into the culture medium. The transformant with the largest number of recombinant plasmids integrated into the fungal genome was chosen for induced expression of PsINV protein. The largest quantity of the expressed protein was detected in the cell-free culture filtrates at 120 h post-induction. Western blot analysis of the recombinant protein confirmed that the target protein is expressed (Fig. S3). Enzyme activity was detected by hydrolysis of sucrose with the soluble PsINV in vitro. Using the DNS colorimetric method, sucrose was shown to be hydrolyzed into reducing sugars (Fig. 4b). This result further confirms that PsINV is a true invertase and suggests that the expressed protein can be utilized for further biochemical characterization.

Enzymatic characterization of PsINV

Enzymatic characterizations of PsINV were performed with purified PsINV protein. By changing the incubation temperature, it was shown that the optimum temperature of PsINV is c. 40°C (Fig. 5a). The optimum pH was confirmed to be slightly below pH 5.0 (Fig. 5b). The Michaelis–Menten kinetics of the enzyme was determined using the Lineweaver–Burk method. The Km was determined to be 19.92 mM under optimal conditions (Fig. 5c). In addition, the effects of different divalent metal ions and EDTA were tested independently (Fig. 5d). Zinc and ferrous ions had no effect on enzyme activity. By contrast, copper ions inhibited the enzyme activity significantly and could even completely suppress activity. However, manganese ions enhanced enzyme activity twofold. Addition of EDTA resulted in a decrease in enzyme activity. This suggests that manganese ions may be a co-factor of this invertase.

Functional analysis of different domains

As described earlier, a rust fungi-specific sequence was discovered in this gene. Therefore, further research into the functions of each domain was conducted. Fragments with deletions of different domains were obtained and used for both heterologous expression and eukaryotic expression with the full gene as the positive control. With the heterologous expression system, it was shown that only PsINVΔN1 could complement the invertase defect, but the transformant grew more slowly than the positive control (Fig. 6b). The proteins PsINVΔN, PsINVΔN1, PsINVΔN2 and PsINVΔC expressed by heterologous expression were tested for invertase activity as described earlier (Fig. S4). PsINVΔN, PsINVΔN2 and PsINVΔC had no activity, whereas PsINVΔN1 was active but had lower activity than PsINV (Fig. 6a). Taken together, these results indicate that the N2 domain and C domain are required for invertase activity, whereas the N1 domain seems to regulate the invertase activity level.

HIGS for PsINV

Due to the lack of a stable genetic transformation system for Pst, BSMV-induced RNAi of pathogen genes, termed HIGS, has been developed as a useful tool for studying the function of pathogenic genes by silencing gene expression and has been commonly used in biotrophic pathogens of cereals (Nowara et al., 2010 Nirmala et al., 2011 Panwar et al., 2013 Cheng et al., 2015 ). Three independent fragments of PsINV were designed for silencing the expression of this gene during the Pst infection process. The three fragments were selected to have no effect on expression of the wheat invertase genes with no more than 11 consecutive identical nucleotides observed between PsINV and all wheat invertase genes accessed on NCBI (Fig. S5) (Senthil-Kumar et al., 2007 ). At 10 dpi with BSMV, plants inoculated with BSMV:00, BSMV:PsINV1as, BSMV:PsINV2as, BSMV:PsINV3as and BSMV:PsSRPKLas all displayed the same phenotype of mild chlorotic mosaic symptoms but showed no significant defects in wheat growth and development. However, plants inoculated with BSMV:TaPDSas showed severe symptoms of Chl photobleaching, suggesting that the BSMV-HIGS system worked well (Fig. 7a). With the plants inoculated with BSMV:00 as negative controls and the plants inoculated with BSMV:PsSRPKLas as positive controls, the rust disease phenotypes of the plants inoculated with PsINV silencing constructs were photographed at 14 dpi of fresh Pst CYR32 urediospores. A significant reduction in sporulation was observed on wheat leaves inoculated with the PsINV silencing constructs compared with leaves of the positive control (Fig. 7b). Counting uredia on infected leaves further supports this conclusion (Fig. 7c). The biomass of Pst also shows a decrease in PsINV-silenced plants (Figs 7d, S6). As the expression of PsINV was significantly reduced in PsINV-silenced plants (Fig. 7e), these results indicate that PsINV seems to contribute to pathogenicity of Pst on wheat leaves.

Histological analysis of the effect of silencing PsINV

Cytological effects of silencing PsINV on Pst growth and development were determined at different infection stages at 24, 48, 120 and 168 hpi. In plants inoculated with the three PsINV-silencing constructs, no significant difference was observed in fungal development compared with in the plants inoculated with BSMV:00 at 24 hpi (Table S2). Secondary hyphae formed normally in control plants at 48 hpi, whereas growth of Pst lagged in PsINV-silenced plants as the primary hyphae were swollen and no secondary hyphae formed (Fig. 8). At 120 hpi, when many haustoria were formed, the infection areas of Pst in PsINV-silenced plants were much smaller than those in the control plants. In addition, the pustule bed matured imperfectly when PsINV was silenced at 7 dpi when the sporulation structure begins to form. The sporulation bed was undeveloped and unable to produce spores. This result suggests that silencing PsINV not only inhibits growth and development of Pst but also has strong effects on sporulation.


Discussion

Field Testing

The practical course is performed once a year, generally in three 1-week session with 18 to 24 students each week. Students are teamed up with a partner randomly, to promote the formation of interdisciplinary teams. Each group of two students is assigned to a workstation with a bioreactor. In this section, data from classes of 2012 to 2014 are presented, with a total number of 178 students: 57 (2012), 59 (2013), and 62 (2014), respectively. Students' subjective opinion and perception of the course was evaluated. This has been performed within the frame of an official anonymous routine evaluation of university teaching of the German state of Baden-Wuerttemberg. The results are presented in Fig. 5 and includes both students own assessment of learning outcomes as well as level of the course and teaching quality.

Students were asked to answer each question on a scale from 1 to 5 (e.g. from 1—“very clear” to 5—“not at all”), as described in Fig. 5. Students reported that the course was meaningful to them and their studies (questions 1 and 3) and that both preliminary knowledge required as well as the level of the course were slightly above average (questions 4 and 6). In addition, more than 90% of students from all classes reported a gain in knowledge, choosing either “1—completely true” or “2—mostly true” (question 5). Comparing the results from the evaluation, student's overall perception and acceptance of the lab course is positive throughout the classes of 2012-2014.

Evidence of Student Learning

Students from classes of 2013 and 2014 participated in short written prelab and postlab exams. In addition, every participant was required to submit a lab journal upon completion of the course, and students' practical skills were monitored and assessed during their time in the lab.

Comparing the data obtained by written exams, the learning outcome of the course could be assessed (Table 3). Prelab written exams were performed anonymously by randomly generated tests containing at least two questions from each category according to Table 1. Postlab written exams were structured similarly and were performed on the last day of the course. A summary of potential questions, which may be used for this purpose, are provided as Supporting Information (S2). Students' answers were then rated for each category, and classified as either “outstanding,” “reasonable,” or “needs improvement.” Data from Table 3 show that in all four categories (corresponding to four learning objectives, Table 1), at least 95% of the participants showed at least satisfactory learning outcome (ranked as either “outstanding” or “reasonable”) in postlab exams. In comparison, this was only achieved by less than one fourth of the students in all categories of prelab exams.

Question/task (category) Outstanding Reasonable Needs improvement
A. Outline components and peripherals of a typical small-scale bioreactor system and place them in the right context. Complete representation of all relevant components, functions assigned correctly 79 (5)% Most components and functions assigned correctly 16 (11)% Several vital components missing and mostly assigned the wrong function 5 (84)%
B. Explain offline and online analytics used in this experiment and outline how crucial fermentation parameters can be extracted from the online data. Complete representation of applied online and offline analytics, principles of measurement explained and link to fermentation parameters (e.g. OTR) established 32 (5)% Mentioned most principles with clear description of methods, lacking description of link to fermentation parameters 65 (19)% Mentioned some analytics, inaccurate representation of methods, did not establish link to characteristic parameters 4 (77)%
C. Explain the expression system and state what is required to produce recombinant protein with this system. Complete representation of all relevant aspects (e.g. catabolic repression). Mentioned genetic setup and plasmid components 14 (8)% Most aspects explained, plasmid components explained to some extent 83 (11)% Description of fundamentals obscure, did not mention plasmid 4 (82)%
D. Explain why different modes of operation or used for the experiment, and what purpose they serve. Accurate division into batch and fed-batch mode, explanation why this is necessary, provided approximate reference values (e.g. growth rate, yields) for different stages 44 (3)% Accurate division into batch and fed-batch mode with basic explanation why this is necessary 51 (9)% Division into batch and fed-batch illustrated, explanation why this is necessary absent or incorrect 5 (88)%
  • Presented data have been obtained from a total of 121 students from classes of 2013 (59 students) and 2014 (62 students). Sample questions for each category are available as Supporting Information S2. One representative question from each category assigned to learning objectives 3 to 6 (Table 1) is shown which has been rated according to the guidelines presented above.

Additionally, criteria have been developed to classify students' behavior during the practical part of the experiment. These criteria, besides general organization as mentioned above, include students' ability to engage in teamwork, as well as cleanliness of the workstation, abilities which are otherwise very hard to assess during written exams. The main criteria for classification are provided in Table 4, and a detailed list can be found in Supporting Information S4. The assessment was performed by regular informal in-lab interviews with associated tentative questioning by the supervisors. Using this method, instructors could accompany the experiment without conveying too much pressure on the students. Therefore, difficulties in understanding of individual participants could be identified early and addressed properly, which was found to be suitable tool to account for a potential variable background of the students. According to this procedure, students learning outcome in the practical part was classified as either “outstanding,” “reasonable,” or “needs improvement.” The results of this classification are shown in Table 4. Approximately 92% of students displayed at least satisfactory behavior and skills.

Question/task Outstanding Reasonable Needs improvement
Scientific analysis and documentation of data in the students individual lab journal. Complete and correct analysis and interpretation of all fermentation data, advanced interpretation of characteristic parameters, outstanding scientific writing 14% Correct analysis and interpretation of most data, advanced calculations performed in part, acceptable scientific writing 80% Several calculations missing or incorrect, incomplete representation of data, no advanced calculations, scientific writing below average 7%
Planning and execution of experimental procedures. Well-organized planning and development of an experimental schedule, outstanding division of tasks and teamwork 14% Mostly well-organized planning, reasonable experimental schedule, workflow organized as a team 78% Planning and experimental schedule only in cooperation with supervisor, no teamwork evident 9%
  • Presented data have been obtained from a total of 121 students from classes of 2013 (59 students) and 2014 (62 students). Students were rated according to the guidelines presented below. Details on the assessment are available as Supporting Information (S4).

Student's lab journals, which contained data and calculations as well as experimental descriptions, were evaluated to assess students understanding of the complex background and scientific writing skills. The assessment focused on correctness and understanding of necessary calculations and interpretation of common characteristic parameters as well as the ability to put the content of the course in a correct context. The comparison of these results to values common to other bioreactor systems or bioprocesses is meant to enhance students' critical-thinking skills. The classification was performed according to criteria in Table 4, and ranked as explained above. Approximately 94% of students displayed at least satisfactory results.

Sample Data

During the experiment, several online and offline parameters had to be monitored by the students. These include time course measurements of biomass (cX), online monitoring of dissolved oxygen (pO2), glucose (cglc), and acetate (cac) concentration, exhaust gas analysis (xO2, xCO2) as well as acid and base volumes added to the bioreactor for pH control. A typical set of results is depicted in Fig. 3. In batch mode, the biomass increases exponentially from the initial value at the point of inoculation of approximately 0.1 g to a total of approximately 1.5 g once the initial amount of 2.5 g glucose is depleted. Due to overflow metabolism, acetate is produced and accumulates, respectively. After the end of the batch process on glucose, the consumption of acetate accounts for a slower growth rate, represented by a smaller gain in biomass between t = 5 h and t = 6.5 h. The growth profile in batch mode is furthermore shown by the online parameters pO2, xO2, and xCO2. During growth on glucose (t = 0–5 h), pO2 as well as xO2 decline while xCO2 increases, as biomass is produced. The increase in pO2 at t = 4 h (Fig. 3, indicated by a star) corresponds to an increase in stirrer speed, which has been automatically adjusted by the process control software to prevent oxygen limitation. Upon adjustment of the metabolism from glucose to acetate at t = 5 h, pO2 as well as xO2 increase, due to the slower metabolic rate. The time course of xCO2 follows xO2 in an opposite way, since less O2 consumed causes less CO2 to be produced. The third increase in pO2 at t = 6.5 h indicated the depletion of acetate, and therefore the starting point for the first fed-batch. During the exponential growth phase, ammonia is consumed as the only available source of nitrogen, which results in a need for pH adjustment. Base is added to maintain a constant pH, which stops once glucose is depleted. The consumption of acetate leads to the addition of acid (t = 5–6.5 h), respectively.

Exemplary results from online and offline monitoring of the process. Online data are available for pO2, xO2, xCO2, and the amount of acid and base added for adjustment of pH. Offline measurements as absolute values are provided for biomass, glucose, and acetate. Different modes of operation are indicated by orange vertical lines which indicate the transitions from batch phase (t = 0–6.5 h) to first fed-batch (t = 6.5–10.5 h) and second fed-batch (t = 10.5–30 h). Stirrer speed has been adjusted from 400 rpm to 500 rpm by process control software to enhance oxygen transfer to the culture broth at t = 3.5 h (indicated by a star), which results in a rise in pO2 of no significance to the determination of substrate depletion. Biomass growth in the second fed-batch is approximated by assuming exponential growth with µ = 0.1 h −1 (dark green, solid line).

During exponential feeding in the first fed-batch (FB1, t = 6.5–10.5 h) pO2, xO2, xCO2 and base levels behave as described for the batch process during glucose consumption. To maintain a constant growth rate of µ = 0.5 h −1 , limiting amounts of glucose are fed resulting in limiting concentrations of glucose in the fermentation broth. The addition of acid at the end of the first fed-batch process may be attributed to the degradation of small levels of acetate which formed during feeding.

The second fed-batch begins at t = 10.5 h, and the growth rate is set to µ = 0.1 h −1 by adjusting the feeding rate. This decrease in growth rate is represented by a slower formation of biomass and lower amount of glucose fed to promote cAMP formation. This, besides the induction with rhamnose, which is added at the beginning of the second fed-batch, is a prerequisite for the production of recombinant eGFP (refer to section “Scientific background”). Additionally, at that point, the gassing rate is increased to eliminate the risk of oxygen limitation at higher cell densities, since this step is usually performed overnight. The increase in pO2 at the beginning of the second fed-batch (FB2, t = 10.5–30 h) can be attributed to the increase of gassing rate, the decreased temperature as well as the lower growth rate. No distinct changes in xO2 and xCO2 can be observed during the second fed-batch due to the higher gas flow rate.

Regarding the product yield, it is especially important to control the addition of feed solution during the early production phase (fed-batch 2), where incorrect dosage of feed solution will cause a buildup of both glucose and acetate, thereby dramatically lowering final eGFP yield. The adjustment of temperature from 37°C to 30°C, which is typically performed in experiments with inducible protein expression to enhance the amount of correctly folded, active protein, only had a small effect on final levels of active eGFP. However, due to didactic reasons, this temperature shift was not removed from the procedure.

The visual result of the experiment, the fluorescence of eGFP is visualized under UV both in the bioreactor as well as the biomass pellets (Fig. 4). At the end of the second fed-batch, at t = 25–30 h, an accumulation of glucose and acetate can be observed. The increase in glucose and acetate levels may be attributed to transport and mixing issues occurring at high cell densities. An inhomogeneous culture may lead to high local concentrations of glucose which triggers the formation of acetate. Additionally, local gradients may occur due to drop-wise feeding of glucose. Furthermore, sampling reduces the total volume of the culture, which is not covered by feeding control. Over time, this may result in higher amounts of glucose being added to the reactor, leading to a potential accumulation of acetate.

eGFP-fluorescence at the end of the fermentation. (a) eGFP-producing bacteria can easily be visualized in the glass vessel of the bioreactor by using UV light. (b) The process of eGFP-production during the fermentation becomes apparent by comparing frozen cell-pellets under UV light.

Student perception on their learning experience during the lab course. Presented data have been collected within the frame of the official evaluation of higher education at the Karlsruhe Institute of Technology (KIT), in a program established at all universities of the German state of Baden-Wuerttemberg. Evaluation data were collected anonymously in written form on the last day of the lab-course. The amount of students participating in the study were 57 (2012), 59 (2013), and 62 (2014), respectively.

Based on online and offline measurements, key process parameters are calculated and interpreted by the students. These parameters include the total biomass, maximum growth rate (µmax), biomass yields for glucose and oxygen (YX/glc, YX/O2), oxygen transfer rate (OTR), and the volumetric oxygen mass transfer coefficient (kLa). Sample results and typical ranges are summarized in Table 2.

Possible Modifications

The lab course, as described within this work, requires for a specific setup of equipment and peripherals besides the bioreactor. However, there is room for significant variations, both in terms of timeframe and scope as well as with respect to the available equipment. For example, if no exhaust gas analyzer is available, a dynamic method can be employed for the calculation of OTR, which does not require for online exhaust gas monitoring. The course can easily be extended to a 2 or 3-week session, which may be achieved by broadening the scope. Thereby, other disciplines like genetics and molecular biology gain a stronger representation in the lab course. One way could be the integration of genetic engineering in week 1, where the students are preparing the bacterial strain for use in the experiment on the next week. This could include the amplification of the target gene by PCR, the restriction digest of the appropriate plasmid and gene, as well as ligation and transformation of the construct. The week after the production of recombinant protein in the bioreactor could be used for downstream processing. This may be performed using purification by affinity chromatography with tagged proteins. The construct used in this lab course leads to expression of 6xHis-tagged eGFP on the C- and N-terminus, which can be purified by immobilized metal affinity chromatography (IMAC). The purity of the obtained fractions during purification may then be determined by SDS-PAGE with subsequent protein staining, or by quantification using fluorescence readings combined with determination of total protein content. Another potential modification of the lab course would be an alteration of the tasks towards an engineering perspective. The setup of the experiment is suitable for an exercise in the field of control engineering, e.g. the development and programming of appropriate controllers or software, e.g. for the feeding process.


  1. Prepare the blood agar base as instructed by the manufacturer. Sterilize by autoclaving at 121°C for 15 minutes.
  2. Transfer thus prepared blood agar base to a 50°C water bath.
  3. When the agar base is cooled to 50°C, add sterile blood aseptically and mix well gently. Avoid the formation of air bubbles. You must have warmed the blood to room temperature at the time of dispensing to the molten agar base.
    (Note: If you are planning to prepare a batch of blood agar plates, prepare few blood agar plates first to ensure that blood is sterile).
  4. Dispense 15 ml amounts to sterile Petri plates aseptically
  5. Label the medium with the date of preparation and give it a batch number (if necessary).
  6. Store the plates at 2-8°C, preferably in sealed plastic bags to prevent loss of moisture. The shelf life of thus prepared blood agar is up to four weeks.
  1. The pH of the blood agar range from 7.2 to 7.6 at room temperature.
  2. Inoculate the plates with 5-hour broth cultures of Streptococcus pyogenes and S. pneumoniae.Inoculate also a plate with H. influenzae and streak with S. aureus (i.e. Satellitism Test).
  3. Incubate the plates in a carbon dioxide enriched atmosphere at 35-37°C overnight.
  4. Check for the growth characteristics of each species
    1. S. pyogenes: Beta-hemolysis
    2. S. pneumoniae: Alpha-hemolysis

    Materials and Methods

    P. falciparum culture and maintenance

    Unless otherwise noted, blood-stage P. falciparum parasites were cultured in human erythrocytes at 1% hematocrit in a 10 ml total volume of CMA (Complete Medium with AlbuMAX II) containing RPMI 1640 medium with l -glutamine (USBiological Life Sciences), supplemented with 20 mM HEPES, 0.2% sodium bicarbonate, 12.5 μg/ml hypoxanthine, 5 g/l AlbuMAX II (Life Technologies), and 25 μg/ml gentamicin. Cultures were maintained in 25-cm 2 gassed flasks (94% N2, 3% O2, 3% CO2) and incubated at 37°C.

    Generating markerless PfMev P230p-attB parasites

    A 1.2 kB region of the p230p gene (PF3D7_0208900) was amplified from PfMev genomic DNA using primers P230p.HA.F and P230p.HA.R (Appendix Table S2). These primers were designed to contain

    15 bp overhangs which allowed insertion of the amplicon into the NgoMIV site of pRS (Swift et al, 2020b ) by ligation independent cloning (In-Fusion, Clontech). The plasmid was digested with BglII to excise a 210bp fragment between two BglII sites in the p230p gene. The excised region was replaced with an oligo comprised of complementary primers attBr. InF.F and attBr. InF.R (Appendix Table S2) using In-Fusion to generate an attB site flanked by p230p homology arms. The plasmid was then digested with BsaI to insert a segment of DNA encoding a guide RNA targeting the excised region of p230p. Complementary primers P230p.gRNA.F and P230p.gRNA.R (Appendix Table S2) were annealed and inserted using ligation independent cloning with In-Fusion (Clontech). The resulting plasmid pRS-P230p was used along with pCasG (Rajaram et al, 2020 ) in transfections for markerless insertion of the attB element into the P230p locus of PfMev parasites. After 48 h, transfectants were selected with 1.5 μM DSM1 for 7 days and 2.5 nM WR99210 for 10 days. Parasite clones were characterized by genotyping PCRs (Fig 2A) using primers described in Fig EV1 and Appendix Table S2.

    Generation of the PfMev EcDPCK complementation lines

    The E. coli complementation constructs were generated from the p15-Mev-aSFG plasmid (GenBank: MN822298) containing a bidirectional Cam/HOP promoter (Swift et al, 2020b ). On one side of the promoter, a drug resistance marker can be inserted into the BamHI/HindIII sites on the other side, transgenes can be inserted into the AvrII/AflII sites. The plasmid also contains an attP site for integration into PfMev P230p-attB parasites (Nkrumah et al, 2006 Spalding et al, 2010 ). Unless noted, the construction of the complementation plasmids used ligation independent cloning with In-Fusion (Clontech).

    The hDHFR drug resistance cassette was amplified from the pRS-LacZ plasmid (GenBank: MN822297) (Swift et al, 2020b ) using the primers listed in Appendix Table S2 (hDHFR.F and hDHFR.R) and inserted into the BamHI/HindIII sites of p15-Mev-aSFG to generate p15-hDHFR. The sequence encoding E. coli DPCK (EcDPCK) was amplified from E. coli genomic DNA using the primers in Appendix Table S2 (EcDPCK.F and EcDPCK.R) and inserted into the AvrII/BsiWI sites of the pLN-TP-ACP-mCherry plasmid (Gisselberg et al, 2013 ) to generate pLN-EcDPCK-mCherry. The entire EcDPCK-mCherry region was then amplified from this plasmid using the primers in Appendix Table S2 (CamEcDpmCry.F and CamEcDpmCry.R) and inserted into the AvrII/AflII sites of p15-hDHFR to generate p15-EcDPCK-mCherry.

    For the generation of the apicoplast-localized E. coli DPCK-mCherry protein, the pLN-TP-ACP-mCherry plasmid (Gisselberg et al, 2013 ) was cut with AvrII/BsiWI. The N-terminal signal and transit peptide, corresponding to the first 55 amino acids of the P. falciparum ACP protein (Api55), was amplified from p15-Mev-aSFG using the primers in Appendix Table S2 (pLN. Api55.F and pLN. Api55.R) and inserted upstream of the mCherry sequence to form the pLN-Api-mCherry plasmid. The sequence encoding EcDPCK was then amplified from E. coli genomic DNA using the primers in Appendix Table S2 (Api. EcDPCK.F and Api. EcDPCK.R) and inserted into the BsiWI/BspEI sites of the previous plasmid. The resulting sequence, comprised of Api55, EcDPCK, and mCherry, was amplified from the pLN-Api-EcDPCK-mCherry plasmid using the primers in Appendix Table S2 (CamApEcDpmC.F and CamApEcDpmC.R) and then inserted into the AvrII/AflII sites of p15-hDHFR to generate p15-Api-EcDPCK-mCherry.

    The PfMev P230p-attB parasite line was transfected with either the p15-EcDPCK-mCherry or p15-Api-EcDPCK-mCherry plasmids along with the pINT plasmid encoding the bxb1 integrase (Nkrumah et al, 2006 Spalding et al, 2010 ). Integrants were selected for with 2.5 nM WR99210 for 7 days, after which point drug pressure was removed. Infected RBCs were then observed

    20–25 days post-transfection, at which point 2.5 nM WR99210 was added back, with the parasites maintained in the presence of this drug. Parasite lines were characterized by genotyping PCR (Fig EV2A and B) using primers listed in Appendix Table S2.

    Generation of the P. falciparum DPCK localization line

    The gene encoding P. falciparum DPCK (PF3D7_1443700) was amplified from cDNA using the primers (DPCK.loc.F and DPCK.loc.R) listed in Appendix Table S2 and inserted into the AvrII/BsiWI sites of p15-Api55-EcDPCK-mCherry to generate p15-PfDPCK-mCherry. This plasmid was transfected into the PfMev P230p-attB parasite line along with pINT (Nkrumah et al, 2006 Spalding et al, 2010 ). Parasites were selected and validated as described above.

    Live cell epifluorescence microscopy

    Approximately 100 μl of resuspended parasite cultures was incubated with 1 µg/ml 4′, 6-diamidino-2-phenylindole (DAPI) for 30 min at 37°C. Cells were then washed three times with 100 μl of CMA medium and incubated for 5 min at 37°C after each wash. Cells were resuspended in 20 μl of CMA and then pipetted onto slides and sealed with wax for observation on a Zeiss AxioImager M2 microscope. A series of images spanning 5 µm in the z-plane were acquired with 0.2 µm spacing, and images were deconvolved using the VOLOCITY software (PerkinElmer) to report a single image in the z-plane.

    Generation of P. falciparum plasmid constructs for gene deletion

    DPCK was targeted for deletion through Cas9-mediated gene editing, using the pL8 plasmid (Swift et al, 2020b ), in combination with the pUF1-Cas9 plasmid, which was generously provided by Dr. Jose-Juan Lopez-Rubio (Ghorbal et al, 2014 ). To generate pL8-DPCK, two DPCK homology arms (HA1 and HA2) and a 20 bp guide RNA were inserted into pL8. HA1 (562bp) was amplified with primers DPCK.HA1.F and DPCK.HA1.R, and HA2 (393bp) was amplified with primers DPCK.HA2.F and DPCK.HA2.R (Appendix Table S2). HA1 was inserted into the NotI site, and HA2 was inserted into the NgoMIV site of pL8 using In-Fusion. Primers DPCK.gRNA.F and DPCK.gRNA.R (Appendix Table S2) were annealed and inserted into the BtgZI sites of pL8 to form pL8-DPCK. For deletion of DPCK in the EcDPCK complementation lines, the gene encoding hDHFR in pL8-DPCK was replaced by a codon harmonized gene encoding residues 2–129 of the Aspergillus terreus blasticidin-S deaminase (BSD) synthesized by LifeSct. The harmonized bsd gene (Appendix Fig S2) was amplified using the primers pRsBSD.F and pRsBSD.R (Appendix Table S2) and inserted into the BamHI/HindIII sites of pL8-DPCK using ligation independent cloning (In-Fusion, Clontech).

    P. falciparum transfections for attempted gene deletion of DPCK

    Transfections were conducted as previously described (Spalding et al, 2010 ). Briefly, 400 μl of RBCs was electroporated with 75 μg each of the Cas9 expression plasmid and the pL8-DPCK homology repair plasmid. The transfected RBCs were then mixed with synchronized schizont-stage PfMev parasites. After

    48 h, drug-selection was initiated by the addition of 1.5 μM DSM1, 2.5 nM WR99210, and 50 µM mevalonate, with or without 5 mM CoA.

    Generation of the PfMev CLD-EcDPCK-mCherry-apt parasite line

    In order to generate the p15-CLD-EcDPCK-mCherry-apt plasmid, the p15-Api-EcDPCK-mCherry plasmid was digested with AvrII and BspEI in order to remove the ACP signal and transit peptide sequence. The conditional localization domain sequence was then amplified from the pLN-CLD2-HCS1 plasmid (Roberts et al, 2019 ) using the primers listed in Appendix Table S2 (CLD.F and CLD.R). The CLD-EcDPCK-mCherry gene sequence was then amplified using the CLD.F and EcDPCK.CLD.R primers (Appendix Table S2), and inserted into the p15-aFluc-mCh plasmid (Swift et al, 2020a ), previously digested with AvrII and PspOMI, using In-Fusion cloning. See Appendix Fig S3 for plasmid sequence. This plasmid, along with the pINT plasmid encoding the bxb1 integrase for attP/attB integration, was transfected into p230p attB PfMev parasites and selected with 2.5 µg/ml blasticidin for 7 days, after which drug pressure was removed. Parasites were observed via Giemsa stain 20–25 days later, at which point the parasites were again cultured in the presence of 2.5 µg/ml blasticidin.

    Deletion of DPCK in the PfMev EcDPCK-mCherry, PfMev api-EcDPCK-mCherry, and PfMev CLD-EcDPCK-mCherry-apt lines

    The PfMev EcDPCK-mCherry and PfMev api-EcDPCK-mCherry lines were transfected with the pL8-DPCK (BSD) plasmid along with the pUF1-Cas9 plasmid. The parasites were selected with 2.5 µg/ml blasticidin and 1.5 μM DSM1 for 7 days, also in the presence of 2.5 nM WR99210. After 7 days, blasticidin and DSM1 were removed. Infected RBCs were then typically seen after

    20–25 days. After parasites were observed, the cultures were then maintained in the presence of 2.5 nM WR99210 and 2.5 µg/ml blasticidin.

    For the deletion of DPCK in the PfMev CLD-EcDPCK-mCherry-apt parasite line, the original pL8-DPCK plasmid containing the DPCK homology arms flanking the hDHFR drug selectable marker was used. Parasites were transfected with the pL8-DPCK (hDHFR) plasmid along with the pUF1-Cas9 plasmid. Parasites were then selected with 2.5 nM WR99210 and 1.5 μM DSM1 for 7 days, also in the presence of 2.5 µg/ml blasticidin. After 7 days, WR99210 and DSM1 were removed. Infected RBCs were then typically seen after

    20–25 days. After parasites were observed, the cultures were then maintained in the presence of 2.5 nM WR99210 and 2.5 µg/ml blasticidin. Parasites were continuously cultured in the presence of 0.5 µM aTc.

    Confirmation of knockout genotype

    Primers were designed to screen for 5’ integration (Δ5’ reaction primers DPCK.5.F and pL8HA1.R) and 3’ integration (Δ3’ reaction primers pL8HA2.F and DPCK.3.R) of the gene disruption cassette, and the 5’ region (primers DPCK.5.F and DPCK.5.WT.R) and 3’ region (primers DPCK.3.WT.F and DPCK.3.R) of the WT gene (Appendix Table S2). The parental PfMev line was used as a control for these reactions.

    Generation and purification of anti-mCherry rabbit antibodies

    Recombinant mCherry was produced to generate affinity-purified antibodies. Primers mCh.pMAL. EcoRI. For and mCh.pMAL. HindIII. Rev (Appendix Table S2) were used to amplify mCherry for insertion into the pMALcHT E. coli expression vector (Muench et al, 2003 ). mCherry was expressed and purified using the same protocol previously described for the purification of recombinant GFP (Roberts et al, 2019 ). Pure recombinant mCherry was used to generate rabbit antiserum using the custom antibody service of Cocalico Biologicals Inc. Briefly, 250 µg of mCherry mixed with Complete Freund’s Adjuvant was used for the initial inoculation followed by boosts of 125 µg of antigen 2, 3, and 7 weeks later. Final exsanguination was performed on day 56. Specific antibodies were purified from antiserum with a mCherry affinity column using previously described methods (Roberts et al, 2019 ). A total of 18.6 mg of anti-mCherry IgG was concentrated to 3.1 mg/ml and stored at −80°C in storage buffer (PBS, 40% glycerol, 0.02% NaN3).

    Western blotting

    Parasite samples were centrifuged at 500 g for 5 min at room temperature (RT), and pellets were stored at −20°C until the time of protein extraction. To isolate parasites from RBCs, the pellets were thawed and resuspended in 0.15% saponin for 5 min at RT. Lysed RBCs were removed by washing three times with PBS. Parasite pellets were resuspended in NuPAGE LDS sample buffer (Thermo Fisher) containing 2% β-mercaptoethanol and incubated at 95°C for 5 min. Proteins were resolved by SDS–PAGE on 4–12% gradient gels and transferred to nitrocellulose membranes. To detect EcDPCK-mCherry constructs, membranes were blocked in 5% milk and probed overnight at 4°C with 1:10,000 rabbit anti-mCherry (vide supra). They were then incubated for an hour at RT with 1:10,000 donkey anti-rabbit HRP-linked secondary antibodies (GE healthcare, NA934). Protein bands were detected on X-ray film using SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific), according to the manufacturer’s protocol. Membranes were stripped of antibody with 200 mM glycine (pH 2.0) for 5 min and probed with 1:2,500 rat anti-HA mAb 3F10 (Roche) in order to detect api-SFG which contains a C-terminal HA tag (Swift et al, 2020b ). After incubation with 1:5,000 goat anti-rat HRP-linked secondary antibodies (GE healthcare, NA935), proteins were detected as described above.

    Growth curve for the PfMev CLD-EcDPCK-mCherry-apt Δdpck line

    A culture of PfMev CLD-EcDPCK-mCherry-apt Δdpck parasites was washed four times with 10 ml of CMA in order to remove aTc. Parasites were then used to seed two separate 25-cm 2 flasks, each at 1% hematocrit in a 10 ml total volume of CMA media, and a starting parasitemia of

    0.5%. One flask was supplemented with 0.5 µM aTc, representing the permissive condition, while the other was treated with 0.5 µM Shield1, representing the non-permissive condition. The appropriate media were replaced approximately every 24 h, at which point a blood-film was made, and the parasitemia was determined via Giemsa stain. On day 4 of this growth curve, the parasitemia was diluted 1:10.

    Pantothenate titration growth curve

    Pantothenate-free media was generated, consisting of RPMI 1640 media with L-glutamine, and without pantothenate (USBiological Life Sciences #R8999-01A), supplemented with 20 mM HEPES, 0.2% sodium bicarbonate, 12.5 μg/ml hypoxanthine, 5 g/l AlbuMAX II (Life Technologies), and 25 μg/ml gentamicin. PfMev parasites were washed with 10 ml pantothenate-free media three times in order to remove the preexisting pantothenate from the culture. Parasites were then seeded into a 96-well plate at a starting parasitemia of 0.5, 2% hematocrit, and a total volume of 250 µl per well. Pantothenate was then added back to the wells containing pantothenate-free medium at a concentration of 0, 10, 50, 250 nM, or 1 μM, with CMA as a control. The appropriate media were replaced approximately every 24 h, at which point samples were collected for analysis via flow cytometry using previously described methods (Swift et al, 2020b ). On day 4 of this growth curve, the parasitemia was diluted 1:5. In Fig EV5, error bars represent the standard error of the mean from two independent experiments, each conducted in quadruplicate.

    Growth curves for the PfMev CLD-EcDPCK-mCherry-apt Δdpck line under limiting pantothenate concentrations

    The PfMev CLD-EcDPCK-mCherry-apt Δdpck line was washed with 10 ml pantothenate-free media four times in order to remove aTc and pantothenate. Parasites were then seeded into a 96-well plate (Corning) at a 0.5% starting parasitemia, 2% hematocrit, and a total volume of 250 µl per well in quadruplicate. Pantothenate was added back to the pantothenate-free medium to yield a final concentration of 50 nM. Two conditions were tested: The parasites were either supplemented with 0.5 µM aTc, representing the permissive condition, or with 0.5 µM Shield1, representing the non-permissive condition. The appropriate media were replaced approximately every 24 h, at which point samples were collected for analysis via flow cytometry using previously described methods (Swift et al, 2020b ). On day 4 of this growth curve the parasitemia was diluted 1:5. In Figs 5G and 6C, error bars represent the standard error of the mean from two independent experiments, each conducted in quadruplicate.

    Inducing apicoplast loss in the PfMev api-EcDPCK-mCherry Δdpck and PfMev CLD-EcDPCK-mCherry-apt Δdpck parasite lines

    The PfMev CLD-EcDPCK-mCherry-apt Δdpck line was cultured in media containing 100 nM azithromycin in the presence of 50 μM mevalonate for 7 days. After 7 days, the parasites were cultured continuously in the presence of 50 μM mevalonate. Loss of the apicoplast was confirmed via PCR using the methods described below.

    Confirmation of apicoplast loss

    The presence of the apicoplast organellar genome was detected by PCR using primers specific for the sufB gene (SufB.F and SufB.R). Control PCRs amplified the lactate dehydrogenase (ldh) gene from the nucleus (LDH.F and LDH.R) and cytochrome c oxidase subunit 1 (cox1) from the mitochondrial genome (Cox1.F and Cox1.R) (Appendix Table S2). For each PCR, 1 µl of parasite culture was added to a 50 µl reaction volume. The parental PfMev line was used as a positive control for apicoplast genome detection.


    REAGENTS AND SOLUTIONS

    FACS buffer

    • 1× Hank's Balanced Salt Solution (HBSS Gibco, cat. no. 14175-095)
    • 10 mM HEPES (Gibco, cat. no. 15630-080)
    • 0.2% BSA (Millipore, cat. no. 126626-50 ml)
    • 1× Antibiotic/Antimycotic Solution (diluted from 100×, Gibco, cat. no. 15240-062)

    HaloTag dsDNA donor sequences

    N-terminal HaloTag sequence:

    500-bp upstream homology arm-GCAGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGT CCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTCCT CCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGACCCATCGCTG CATTGCTCCAGACCTGATCGGTATGGGCAAATCCGACAAACCAGACCTG GGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAG CCCTGGGTCTGGAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGC TCTGGGTTTCCACTGGGCCAAGCGCAATCCAGAGCGCGTCAAAGGTATT GCATTTATGGAGTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAG AATTTGCCCGCGAGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCG CAAGCTGATCATCGATCAGAACGTTTTTATCGAGGGTACGCTGCCGATG GGTGTCGTCCGCCCGCTGACTGAAGTCGAGATGGACCATTACCGCGAGC CGTTCCTGAATCCTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGA GCTGCCAATCGCCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGA ATACATGGACTGGCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGG GGCACCCCAGGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCA AAAGCCTGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCT GCTGCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTG GCTGTCGACGCTCGAGATTTCCGGCGAGCCAACCACTGAGGATCTGTAC TTTCAGAGCGATAAC-500-bp downstream homology arm

    C-terminal HaloTag sequence:

    500-bp upstream homology arm-GAGCCAACCACTGAGGATCTGTACTTTCAG AGCGATAACGATGGATCCGAAATCGGTACTGGCTTTCCATTCGACCCCC ATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGTC CGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTC CTCCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGACCCAT CGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAATCCGACAAAC CAGACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGC CTTCATCGAAGCCCTGGGTCTGGAAGAGGTCGTCCTGGTCATTCAC GACTGGGGCTCCGCTCTGGGTTTCCACTGGGCCAAGCGCAATCCAG AGCGCGTCAAAGGTATTGCATTTATGGAGTTCATCCGCCCTATCCC GACCTGGGACGAATGGCCAGAATTTGCCCGCGAGACCTTCCAGGCC TTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGATCAGAACG TTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCGCTGAC TGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAATCCTGTT GACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCGCCG GTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATGGACTG GCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCACCCCA GGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAAAAGCC TGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCTGCT GCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTGG CTGTCTACTCTGGAGATTTCCGGT-500-bp downstream homology arm

    N-terminal HiBiT-HaloTag sequence:

    500-bp upstream homology arm-GTGAGCGGCTGGCGGCTGTTCAAGAAGA TTAGCGCAGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGG AAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGTCCGCGCGATGG CACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTCCTCCTACGTGTGG CGCAACATCATCCCGCATGTTGCACCGACCCATCGCTGCATTGCTCCAG ACCTGATCGGTATGGGCAAATCCGACAAACCAGACCTGGGTTATTTCTT CGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAGCCCTGGGTCTG GAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGCTCTGGGTTTCC ACTGGGCCAAGCGCAATCCAGAGCGCGTCAAAGGTATTGCATTTATGGA GTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAGAATTTGCCCGC GAGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCA TCGATCAGAACGTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCG CCCGCTGACTGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAAT CCTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCG CCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATGGACTG GCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCACCCCAGGC GTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAAAAGCCTGCCTA ACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCTGCTGCAAGAAG ACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTGGCTGTCGACGCT CGAGATTTCCGGCGAGCCAACCACTGAGGATCTGTACTTTCAGAGCGAT AAC-500-bp downstream homology arm

    C-terminal HaloTag-VS-HiBiT sequence:

    500-bp upstream homology arm- GAGCCAACCACTGAGGATCTGTACTTTCAG AGCGATAACGATGGATCCGAAATCGGTACTGGCTTTCCATTCGACC CCCATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGT TGGTCCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCG ACCTCCTCCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGA CCCATCGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAATCCGA CAAACCAGACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATG GATGCCTTCATCGAAGCCCTGGGTCTGGAAGAGGTCGTCCTGGTCA TTCACGACTGGGGCTCCGCTCTGGGTTTCCACTGGGCCAAGCGCAA TCCAGAGCGCGTCAAAGGTATTGCATTTATGGAGTTCATCCGCCCT ATCCCGACCTGGGACGAATGGCCAGAATTTGCCCGCGAGACCTTCC AGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGATCA GAACGTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCG CTGACTGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAATC CTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAAT CGCCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATG GACTGGCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCA CCCCAGGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAA AAGCCTGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAAT CTGCTGCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGC GCTGGCTGTCTACTCTGGAGATTTCCGGTGTCTCCGTGAGCGGCTG GCGGCTGTTCAAGAAGATTAGC-500-bp downstream homology arm

    Key: blue, HiBiT red, HaloTag green, linker.


    Does adding antibiotic after 5-10 mins of innoculation affect the protein yield or growth? - Biology

    a Institute for Systems Biology, 401 Terry Ave North, Seattle, USA
    E-mail: [email protected]

    b Indi Molecular, Inc., 6162 Bristol Parkway, Culver City, CA 90230, USA

    Abstract

    Antibiotic resistant infections are projected to cause over 10 million deaths by 2050, yet the development of new antibiotics has slowed. This points to an urgent need for methodologies for the rapid development of antibiotics against emerging drug resistant pathogens. We report on a generalizable combined computational and synthetic approach, called antibody-recruiting protein-catalyzed capture agents (AR-PCCs), to address this challenge. We applied the combinatorial protein catalyzed capture agent (PCC) technology to identify macrocyclic peptide ligands against highly conserved surface protein epitopes of carbapenem-resistant Klebsiella pneumoniae, an opportunistic Gram-negative pathogen with drug resistant strains. Multi-omic data combined with bioinformatic analyses identified epitopes of the highly expressed MrkA surface protein of K. pneumoniae for targeting in PCC screens. The top-performing ligand exhibited high-affinity (EC50 ∼50 nM) to full-length MrkA, and selectively bound to MrkA-expressing K. pneumoniae, but not to other pathogenic bacterial species. AR-PCCs that bear a hapten moiety promoted antibody recruitment to K. pneumoniae, leading to enhanced phagocytosis and phagocytic killing by macrophages. The rapid development of this highly targeted antibiotic implies that the integrated computational and synthetic toolkit described here can be used for the accelerated production of antibiotics against drug resistant bacteria.


    Methods

    Strains and plasmids

    E. coli DH10B was used for cloning. E. coli BLR (DE3) and DH1 were used for expression studies with BglBrick vectors. Plasmids and BglBrick parts used in this study are listed in Table 1. Media were supplemented with 100 μg/mL ampicillin, 35 μg/mL chloramphenicol, or 50 μg/mL kanamycin to select for plasmid maintenance. All strains were grown at 30°C unless described otherwise.

    Construction of BglBrick vector parts

    The template plasmids or parts for the BglBrick vectors constructed here are listed in Table 1 and the primers for PCR amplification are listed in Table 2. Each gene component has been either PCR amplified from a template using Phusion™ High-Fidelity DNA polymerase (New England BioLabs, F-530) or digested from template plasmids and incorporated into the BglBrick vector plasmid by standard restriction digestion/ligation method.

    Replication origins

    The p15A origin was obtained from plasmid pZA31-luc, the ColE1 origin from plasmid pZE12-luc, and the pSC101* origin from plasmid pZS*24-MCS1 [39]. A BglII site in the pSC101* origin was eliminated by site-directed mutagenesis. The oligonucleotides used to remove the BglII site in the pSC101* origin were pSC101QC F1 and pSC101QC R1 creating pSC101**. Each origin of replication and terminator sequence module was cloned in using the AvrII and SacI sites. Plasmid pMBIS was used as template for the pBBR1 origin. The BBR1 region was amplified in two parts, and primers were designed to make a C to T point mutation in the overlapping region of the two PCR products to increase the copy number as reported [22]. Forward primer pBBR1 F1 (5'- gatcaCCTAGGctacagccgatagtctggaacagcgc -3') and reverse primer pBBR1 mut R1 (5'- ccggcaccgtgtTggcctacgtggtc -3') were used to generate the first product with a 5'-AvrII site, and forward primer pBBR1 mut F1 (5'- gaccacgtaggccAacacggtgccgg -3') and reverse primer pBBR1 R2 (5'- agatcaACTAGTgcctccggcctgcggcctgcgcgcttcg -3') were used to generate the second product with a 3'- SpeI site. These two parts were then combined in a splice overlap extension-PCR (SOE-PCR) reaction with primers pBBR1 F1 and pBBR1 R2 to create the product containing the entire pBBR1 origin of replication. The PCR product was digested with AvrII and SpeI and ligated with existing intermediate vectors to generate three additional intermediate vectors containing pBBR1 and each antibiotic resistance module.

    Antibiotic resistance

    All antibiotic resistance segments (SacI to AatII) were digested from the parent plasmids listed in Table 1. The BglBrick restriction site found in Cm and Km resistance gene components were removed by site-specific mutagenesis. The oligonucleotides used to remove the EcoRI site in the Cm resistance gene were the forward CmQC F1 (5'-ctttcattgccatacgAaattccggatgagcattc-3') and reverse CmQC R1 (5'-gaatgctcatccggaattTcgtatggcaatgaaag-3') (point mutation is capitalized). The oligonucleotides used to remove the BglII site in the Km resistance gene promoter were KanQC F1 (5'- cctgtctcttgatcagatcAtgatcccctgc-3') and KanQC R1 (5'- gcaggggatcaTgatctgatcaagagacagg-3').

    Rfp (or gfp) and terminator

    The rfp-terminator (rfp-term) module was constructed by splice overlap extension-PCR (SOE-PCR [47]. First, SOE-PCR was performed to generate rfp with BglBrick restriction sites EcoRI and BglII and RBS (TTTAAGAAGGAGATATACAT) on the 5'-end, and with BglBrick restriction sites BamHI and XhoI and a double terminator sequence followed by an AatII site on the 3'-end. Two PCRs were performed to amplify rfp and the terminator separately, using primers to introduce the restriction sites, RBS, and overlapping sequence for SOE-PCR. Forward primer RFP F1 and reverse primer RFP R1 were used to generate the product containing EcoRI, BglII, RBS, and rfp. Forward primer Term F1 and reverse primer Term R1 were used to generate the product containing the BamHI, XhoI, the double terminator sequence and AvrII. The products were then combined and a second PCR was performed with the RFP F1 and Term R1. The resulting SOE-PCR product (rfp-term) was in turn used in additional SOE-PCRs to generate complete modules containing the 8 different promoter systems followed by rfp-term.

    Promoters and repressors

    The primers for each promoter system (containing repressor and promoter) were engineered to include a 5'AatII site for later cloning steps and an rfp overlapping sequence on the 3' end to facilitate the addition of the rfp-terminator module via SOE-PCR. When the promoter system contained any of the 4 BglBrick restriction sites, an additional set of primers to remove the restriction site was prepared for SOE-PCR. Primers for each promoter system are listed in the Table 2.

    Final pBb vector assembly

    To construct the promoter system with the rfp-terminator module, each of the eight promoter system modules were combined with rfp-terminator by SOE-PCR using the F1 primer from each promoter system construction and the reverse primer Term R1. These eight products were then digested with AatII and AvrII and individually ligated with the AatII and AvrII digested fragment from the intermediate plasmid containing amp R and ColE1. The eleven remaining intermediate plasmids were then digested with AvrII and AatII to isolate the antibiotic resistance-replication origin (AR-ori) modules. In total, each of the twelve AR-ori modules was ligated with each of the eight AvrII and AatII digested promoter-rfp-terminator modules to produce 96 unique pBb vectors.

    Data sheet experiments

    General

    Ampicillin-resistant pBb plasmids were transformed into E. coli BLR(DE3) electrocompetent cells and/or E. coli DH1 electrocompetent cells and plated on LB-agar with 50 μg/ml Carbenicillin (Cb) for overnight incubation at 37°C. A single colony was picked and used to prepare the seed culture in LB broth containing 50 μg/ml Cb. Fresh culture tubes with 3 ml LB broth containing 50 μg/ml Cb were inoculated with 60 μl overnight seed culture and grown at 37°C, 200 rpm until the OD600 reached about 0.55. All experiments were replicated in triplicate.

    Inducer dose response

    The outer wells of a 96-well clear-bottom plate with lid (Corning no: 3631) were filled with 200 μl sterile water and the plate was sterilized by using the optimal crosslink setting on the UV crosslinker (Spectronics, Corp.). 10 × serial dilutions were made of inducers appropriate for each plasmid being tested and 20 μl was pipetted into each well so that the final volume of 200 μl would give 1x inducer concentration. Each plate included 3 control wells containing pBbE5a-RFP (or GFP) in BLR(DE3) induced with 12.5 μM IPTG. Appropriate volumes of culture and LB/Cb were added to the 96-well plate with lid and grown in a Safire (Tecan) microplate reader at 30°C for 20.5 hours. OD600 and RFP fluorescence were measured every 570 seconds using an excitation wavelength of 584 nm and an emission wavelength of 607 nm. For the constructs containing GFP (pBbB plasmids), an excitation wavelength of 400 nm and an emission wavelength of 510 nm were used for fluorescence measurement.

    Strain and medium dependence

    E. coli BLR(DE3) and DH1 transformed with pBb plasmid were streaked on LB-agar with 50 μg/ml Cb and grown at 37°C overnight. Seed cultures were prepared in LB broth containing 50 μg/mL Cb inoculated with a single colony and grown at 37°C, 200 rpm overnight. Each experiment with a pBb plasmid-harboring strain was replicated in triplicate, and each set of experiments included 6 control tubes containing pBbE5a-RFP in BLR(DE3) in LB (3 uninduced and 3 induced with 100 μM IPTG). For the M9 minimal medium (MM) experiment, three rounds of adaptation were performed in minimal medium. After adaptation, fresh tubes with 3 mL fresh MM were inoculated with adapted seed culture to OD600 approximately 0.15 and grown at 37°C to OD600 of approximately 0.5. One set of tubes were induced at different inducer concentrations and all cultures were grown at 30°C, 200 rpm for 66 hours post induction. Samples were taken at 18 h, 42 h and 66 h post induction. 25 μL of culture was taken into a 96-well plate and diluted to 200 μL with fresh medium, and OD600 and fluorescence were measured. For LB and TB media experiments, overnight seed cultures were used directly for inoculation without adaptation.

    Catabolite repression and inducer crosstalk

    Seed cultures were prepared as described in strain and medium dependence experiments. Three different media (MM, phosphate buffered LB, and phosphate buffered TB) containing 1% glucose were used for catabolite repression experiments. Inoculated cultures were grown at 37°C to OD600 of approximately 0.5, and induced to achieve maximum expression (100 μM IPTG, 20 mM arabinose, 400 nM aTc, or 20 mM propionate). Cultures were grown at 30°C, 200 rpm for 66 hours post induction, and OD600 and fluorescence was measured at each sampling. For the inducer crosstalk experiment, LB broth containing 50 μg/ml Cb was inoculated with seed cultures containing E. coli BLR(DE3) harboring the ampicillin-resistant pBb. Cultures were induced at OD600 of approximately 0.5 with the appropriate inducer, and one of the non-cognate inducers was also added to the individually induced culture during induction. Cultures were grown at 30°C, 200 rpm for 18 hours post-induction, and OD600 and fluorescence were measured using the Tecan.

    Bacterial DNA isolation to quantify plasmid copy number

    E. coli DH1 and BLR were grown overnight at 30°C, 200 rpm shaking after inoculating 5 mL cultures of LB medium (supplemented with 50 μg/mL kanamycin) with single colonies from freshly streaked plates. After sub-culturing (1:50) into shake flasks containing 50 mL of LB medium (supplemented with 50 μg/mL kanamycin), cells were grown at 30°C, 200 rpm shaking until an OD600 of 0.3-0.4 was reached. At this time, 1 mL of cells was spun down and the supernatant subsequently removed. The cell pellets were then frozen. Total DNA was isolated from these pellets for use at a future date. The DNA isolation method reported in previous publications [33, 48] was adopted. Bacterial cell pellets were resuspended in 400 μL of 50 mM Tris/50 mM EDTA, pH 8, by vortexing. Cell membranes were permeablized by the addition of 8 μL of 50 mg/mL lysozyme (Sigma) in 10 mM Tris/1 mM EDTA, pH 8, followed by incubation at 37°C for 30 min. To complete cell lysis, 4 μL of 10% SDS and 8 μL of 20 mg/mL Proteinase K solution (Invitrogen) were added to each tube, mixed with a syringe with 21-gauge, 1.5-inch needle, and incubated at 50°C for 30 min. Proteinase K was subsequently heat inactivated at 75°C for 10 min, and RNA was digested with the addition of 2 μL of 100 mg/mL RNase A solution (Qiagen) followed by incubation at 37°C for 30 min. Total DNA extraction then proceeded by adding 425 μL of 25:24:1 phenol:chloroform:isoamyl alcohol, vortexing vigorously for

    1 min, allowing the tubes to sit at room temperature for a few minutes, and then centrifugation for 5 min at 14,000 × g, 4°C. Next, 300 μL of the upper aqueous phase was transferred to a new tube using a wide-opening pipet tip. DNA extraction continued by adding 400 μL of chloroform to each tube, vigorous vortexing for

    1 min, allowing the tubes to sit at room temperature for a few minutes, and centrifugation for 5 min at 14,000 × g, 4°C. Next, 200 μL of the upper aqueous phase was transferred to a new tube using a wide-opening pipet tip. Following chloroform extraction, total DNA was ethanol precipitated overnight, washed with 70% ethanol, and finally resuspended in 40 μL of nuclease-free water. DNA concentration and purity were assayed using a Nanodrop spectrophotometer, and integrity examined on 1% agarose gels.

    Real-time qPCR quantification of plasmid copy number

    Primer sets specific to the neomycin phosphotransferase II (nptII) gene (forward: GCGTTGGCTACCCGTGATAT, reverse: AGGAAGCGGTCAGCCCAT) [49] and 16S rDNA gene (forward: CCGGATTGGAGTCTGCAACT, reverse: GTGGCATTCTGATCCACGATTAC) [33] were used for real-time qPCR. These primers amplified a single product of the expected size as confirmed by the melting temperatures of the amplicons. nptII resides in single-copy on the plasmids characterized in this study, while 16S rDNA gene resides on multiple copies on the E. coli chromosome [36] and was used for normalization [22, 33, 35]. In order to determine plasmid copy number (i.e. number of plasmids per genomic equivalent), E. coli DH1 and BLR transgenic strains with a single nptII integration (data not shown) were used for calibration. Total DNA isolated from each strain was first digested overnight using EcoR I (New England Biolabs) at 37°C. Real-time qPCR was conducted on a BioRad iCycler with 96-well reaction blocks in the presence of SYBR Green under the following conditions: 1X iQ SYBR Green Supermix (BioRad), 150 nM nptII (500 nM 16S) primers in a 25 μL reaction. Real-time qPCR cycling was 95°C for 3 min, followed by 40 cycles of 30 sec at 95°C, 30 sec at 60°C, and 30 sec at 72°C. Threshold cycles (Ct) were determined with iCycler (BioRad) software for all samples. A standard curve was prepared for quantification. For this purpose, a four-fold dilution series of a total of seven dilutions was prepared from a digested total DNA sample, and each dilution was subjected to qPCR analysis in at least duplicate with either the nptII- or 16S-specific primers. Obtained Ct values were used by the iCycler software package to plot a standard curve that allowed quantification of nptII or 16S in the digested total DNA samples (i.e. unknowns) relative to the DNA sample used to prepare the standard curve.

    Expression control in the three-plasmid system

    BLR (DE3) cells were transformed with three plasmids: pBbA8a-CFP, pBbE5c-YFP and pBbS2k-RFP. A single colony was used to inoculate LB medium and the overnight cultures were grown at 37°C in minimal medium (M9 medium supplied with 75 mM MOPS, 2 mM MgSO4, 1 mg/L thiamine, 10 nM FeSO4, 0.1 mM CaCl2 and micronutrients) supplemented with 2% glucose. Cells were induced at OD

    0.6 with combinations of different amounts of arabinose, IPTG and aTc. In detail, the arabinose concentrations used were 0, 5 mM, and 20 mM the IPTG concentrations used were 0, 30 μM, and 100 μM and the aTc concentrations used were 0, 12.5 nM, 25 nM, and 40 nM. After induction, cells were grown at 30°C for 12 hours until cell culture fluorescence was measured. Cell culture fluorescence was recorded on a SpectraMax M2 plate reader (Molecular Devices) using 96-well Costar plates with each well containing 150 μl of cell culture. For CFP, λex = 433 nm and λem = 474 nm were used for YFP, λex = 500 nm and λem = 530 nm were used and for RFP, λex = 584 nm and λem = 615 nm were used. Cell density was estimated by measuring the absorbance at 610 nm. Cell culture fluorescence from each well was normalized by its cell density. All the data were average from at least two independent measurements.


    Watch the video: Κεφίρ: τι είναι και γιατί πρέπει να το πίνουμε καθημερινά (August 2022).